\
| Variant ID: vg0106805757 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 6805757 |
| Reference Allele: TATATATAGGTATTA | Alternative Allele: GATATATAGGTATTA,T,AATATATAGGTATTA,TAGATATATAGGTATTA |
| Primary Allele: TATATATAGGTATTA | Secondary Allele: GATATATAGGTATTA |
Inferred Ancestral Allele: Not determined.
TTGGGTTATTTAAGGGCTAAGTTCCTAATTTAAAAAGGTTGAATATATCCGTTTGGATGTAGAGGCCGGGTAAAAATACCATTCTCTCTCTCTATATATA[TATATATAGGTATTA/GATATATAGGTATTA,T,AATATATAGGTATTA,TAGATATATAGGTATTA]
TTCTCTCTCCTTTTCAAAGTATGATGATGAGGTAGATCTAACTGTGAAATTATCAAGAGAAAATTAATAAAGGTTTAGTTTTCAAATTTGCTAGTGCTGC
GCAGCACTAGCAAATTTGAAAACTAAACCTTTATTAATTTTCTCTTGATAATTTCACAGTTAGATCTACCTCATCATCATACTTTGAAAAGGAGAGAGAA[TAATACCTATATATA/TAATACCTATATATC,A,TAATACCTATATATT,TAATACCTATATATCTA]
TATATATAGAGAGAGAGAATGGTATTTTTACCCGGCCTCTACATCCAAACGGATATATTCAACCTTTTTAAATTAGGAACTTAGCCCTTAAATAACCCAA
| Populations | Population Size | Frequency of TATATATAGGTATTA(primary allele) | Frequency of GATATATAGGTATTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.90% | 9.00% | 5.42% | 13.52% | AATATATAGGTATTA: 0.83%; T: 0.28%; TAGATATATAGGTATTA: 0.02% |
| All Indica | 2759 | 70.80% | 1.60% | 5.84% | 20.91% | T: 0.47%; AATATATAGGTATTA: 0.43% |
| All Japonica | 1512 | 74.10% | 24.50% | 0.33% | 0.99% | TAGATATATAGGTATTA: 0.07%; AATATATAGGTATTA: 0.07% |
| Aus | 269 | 58.40% | 1.10% | 23.79% | 10.04% | AATATATAGGTATTA: 6.69% |
| Indica I | 595 | 87.40% | 0.00% | 2.69% | 9.58% | T: 0.34% |
| Indica II | 465 | 52.30% | 0.90% | 10.75% | 35.48% | T: 0.43%; AATATATAGGTATTA: 0.22% |
| Indica III | 913 | 80.50% | 1.00% | 4.49% | 12.49% | T: 0.88%; AATATATAGGTATTA: 0.66% |
| Indica Intermediate | 786 | 57.80% | 3.90% | 6.87% | 30.66% | AATATATAGGTATTA: 0.64%; T: 0.13% |
| Temperate Japonica | 767 | 96.60% | 1.70% | 0.26% | 1.43% | NA |
| Tropical Japonica | 504 | 46.00% | 53.00% | 0.40% | 0.40% | TAGATATATAGGTATTA: 0.20% |
| Japonica Intermediate | 241 | 61.00% | 37.30% | 0.41% | 0.83% | AATATATAGGTATTA: 0.41% |
| VI/Aromatic | 96 | 69.80% | 0.00% | 18.75% | 3.12% | AATATATAGGTATTA: 8.33% |
| Intermediate | 90 | 61.10% | 11.10% | 8.89% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106805757 | TATATATAGGTATTA -> T | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:61.146; most accessible tissue: Zhenshan97 flower, score: 88.357 | N | N | N | N |
| vg0106805757 | TATATATAGGTATTA -> GATATATAGGTATTA | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:61.146; most accessible tissue: Zhenshan97 flower, score: 88.357 | N | N | N | N |
| vg0106805757 | TATATATAGGTATTA -> DEL | N | N | silent_mutation | Average:61.146; most accessible tissue: Zhenshan97 flower, score: 88.357 | N | N | N | N |
| vg0106805757 | TATATATAGGTATTA -> AATATATAGGTATTA | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:61.146; most accessible tissue: Zhenshan97 flower, score: 88.357 | N | N | N | N |
| vg0106805757 | TATATATAGGTATTA -> TAGATATATAGGTATTA | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:61.146; most accessible tissue: Zhenshan97 flower, score: 88.357 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106805757 | NA | 2.22E-10 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 1.68E-09 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 6.73E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 5.67E-07 | 6.80E-10 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 1.54E-06 | 2.34E-11 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 1.54E-10 | 1.08E-08 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 5.88E-09 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 7.92E-07 | 9.55E-20 | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 1.38E-10 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 9.62E-26 | 5.05E-31 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 6.30E-22 | 1.17E-41 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 7.92E-06 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 1.67E-06 | NA | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 3.11E-08 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 2.94E-09 | 1.94E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 3.08E-06 | 3.00E-08 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 1.01E-11 | 2.05E-16 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 4.41E-09 | 4.32E-17 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 2.15E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 1.62E-06 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 7.26E-16 | 5.71E-13 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 6.35E-14 | 8.19E-17 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 2.46E-06 | 8.24E-21 | mr1676_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 7.03E-11 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 7.51E-36 | 1.40E-43 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 2.43E-31 | 1.06E-58 | mr1769_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 1.97E-08 | 2.68E-25 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | NA | 1.54E-13 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 6.35E-09 | NA | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 9.23E-11 | 1.72E-11 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106805757 | 6.88E-09 | 4.85E-10 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |