\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106703618:

Variant ID: vg0106703618 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6703618
Reference Allele: AAlternative Allele: T,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATTGGTTTGATGGCTTGAACTCAAAGTGAAATTTCTAACTTTGGATTTTAAATTTGAATTTGGATTTCTTTTTCCGGATATTATAGTTCTAATTATAT[A/T,AT]
TTTTTTATCTATTTGAGCTTGTTTACTTCTCCTTTTATCCTAAAATATAAGGCTCAACCATTCTTAAAACAATGACTAAGAAAGAATTTAATCGTACTCT

Reverse complement sequence

AGAGTACGATTAAATTCTTTCTTAGTCATTGTTTTAAGAATGGTTGAGCCTTATATTTTAGGATAAAAGGAGAAGTAAACAAGCTCAAATAGATAAAAAA[T/A,AT]
ATATAATTAGAACTATAATATCCGGAAAAAGAAATCCAAATTCAAATTTAAAATCCAAAGTTAGAAATTTCACTTTGAGTTCAAGCCATCAAACCAATCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 9.40% 3.11% 36.27% AT: 0.36%
All Indica  2759 40.20% 6.50% 1.45% 51.50% AT: 0.43%
All Japonica  1512 57.90% 17.50% 6.75% 17.59% AT: 0.33%
Aus  269 99.30% 0.00% 0.37% 0.37% NA
Indica I  595 15.60% 0.20% 1.68% 82.52% NA
Indica II  465 58.70% 22.40% 0.43% 18.49% NA
Indica III  913 37.90% 0.90% 1.64% 58.38% AT: 1.20%
Indica Intermediate  786 50.40% 8.30% 1.65% 39.57% AT: 0.13%
Temperate Japonica  767 65.60% 31.60% 1.30% 1.56% NA
Tropical Japonica  504 47.40% 0.40% 9.13% 42.06% AT: 0.99%
Japonica Intermediate  241 55.20% 8.30% 19.09% 17.43% NA
VI/Aromatic  96 93.80% 2.10% 1.04% 3.12% NA
Intermediate  90 70.00% 1.10% 3.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106703618 A -> T LOC_Os01g12260.1 upstream_gene_variant ; 247.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> T LOC_Os01g12270.1 downstream_gene_variant ; 785.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> T LOC_Os01g12280.1 downstream_gene_variant ; 2469.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> T LOC_Os01g12260-LOC_Os01g12270 intergenic_region ; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> DEL N N silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> AT LOC_Os01g12260.1 upstream_gene_variant ; 248.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> AT LOC_Os01g12270.1 downstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> AT LOC_Os01g12280.1 downstream_gene_variant ; 2468.0bp to feature; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N
vg0106703618 A -> AT LOC_Os01g12260-LOC_Os01g12270 intergenic_region ; MODIFIER silent_mutation Average:86.758; most accessible tissue: Minghui63 root, score: 94.059 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106703618 A AT -0.15 -0.17 -0.04 -0.16 -0.21 -0.28
vg0106703618 A T 0.01 0.02 0.03 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106703618 NA 2.27E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 1.40E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 2.84E-09 2.48E-22 mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 2.98E-22 4.50E-35 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 3.11E-15 1.12E-29 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 2.64E-06 2.64E-06 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 7.86E-09 2.08E-10 mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 1.51E-13 5.15E-18 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 2.02E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 4.02E-10 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 9.30E-17 6.86E-23 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 1.34E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 1.27E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 6.11E-15 2.09E-23 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 1.80E-07 6.09E-11 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 1.29E-18 5.10E-32 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 8.55E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 2.10E-19 7.22E-39 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 5.97E-07 2.10E-07 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 5.57E-06 4.25E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 3.41E-12 3.19E-17 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 2.17E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 NA 1.55E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106703618 2.04E-14 2.89E-23 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251