\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106651186:

Variant ID: vg0106651186 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6651186
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGAGATTCGAAAACTTTCAAGTCCACATTTGAAAATTTTGAAAACTTTCAACTTGAGATTTGAAAATCGAAATTTGAAAACTTTCAACTCAAGATTT[G/A]
AAAACTTTCAAGTTCAAAATTGAAAATTTTTAAGTTACGATTTAAAAATTACTAGTAAACTAATCACTAATAAAAATAGGAAACTAATAACTAGTAAACT

Reverse complement sequence

AGTTTACTAGTTATTAGTTTCCTATTTTTATTAGTGATTAGTTTACTAGTAATTTTTAAATCGTAACTTAAAAATTTTCAATTTTGAACTTGAAAGTTTT[C/T]
AAATCTTGAGTTGAAAGTTTTCAAATTTCGATTTTCAAATCTCAAGTTGAAAGTTTTCAAAATTTTCAAATGTGGACTTGAAAGTTTTCGAATCTCGAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 8.20% 0.78% 25.35% NA
All Indica  2759 69.20% 7.40% 0.91% 22.47% NA
All Japonica  1512 63.80% 0.40% 0.46% 35.32% NA
Aus  269 38.70% 61.00% 0.37% 0.00% NA
Indica I  595 97.80% 0.30% 0.17% 1.68% NA
Indica II  465 32.70% 21.70% 2.15% 43.44% NA
Indica III  913 75.00% 2.50% 0.55% 21.91% NA
Indica Intermediate  786 62.30% 10.10% 1.15% 26.46% NA
Temperate Japonica  767 73.30% 0.00% 0.26% 26.47% NA
Tropical Japonica  504 45.20% 0.80% 0.99% 52.98% NA
Japonica Intermediate  241 72.60% 0.80% 0.00% 26.56% NA
VI/Aromatic  96 72.90% 9.40% 0.00% 17.71% NA
Intermediate  90 63.30% 2.20% 4.44% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106651186 G -> A LOC_Os01g12200.1 upstream_gene_variant ; 1891.0bp to feature; MODIFIER silent_mutation Average:79.11; most accessible tissue: Zhenshan97 flower, score: 93.734 N N N N
vg0106651186 G -> A LOC_Os01g12190.1 downstream_gene_variant ; 664.0bp to feature; MODIFIER silent_mutation Average:79.11; most accessible tissue: Zhenshan97 flower, score: 93.734 N N N N
vg0106651186 G -> A LOC_Os01g12190-LOC_Os01g12200 intergenic_region ; MODIFIER silent_mutation Average:79.11; most accessible tissue: Zhenshan97 flower, score: 93.734 N N N N
vg0106651186 G -> DEL N N silent_mutation Average:79.11; most accessible tissue: Zhenshan97 flower, score: 93.734 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106651186 G A 0.01 0.01 0.02 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106651186 NA 2.41E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 NA 1.88E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 3.15E-12 3.06E-10 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 2.92E-15 2.81E-32 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.04E-06 1.52E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.69E-08 7.58E-25 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 5.77E-09 6.69E-07 mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 7.46E-10 1.89E-14 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.89E-08 5.15E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.16E-12 3.75E-24 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 NA 7.67E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 NA 3.50E-10 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.10E-09 9.43E-14 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.38E-10 1.43E-22 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 5.99E-08 8.82E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.03E-13 1.27E-30 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.82E-07 5.69E-09 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 2.49E-07 6.66E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 8.33E-08 3.66E-12 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 1.35E-07 1.23E-08 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106651186 2.39E-08 1.23E-16 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251