\
| Variant ID: vg0106608619 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6608619 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.15, others allele: 0.00, population size: 59. )
TTTTGCAAAAAGTTTCTATACGAAAGTTGCTTAAAGAATCAAATTAATCTATTTTGAAATTTTTTTTAGCAAATACTTAATTAATCACACGCTAATGGAC[C/T]
GCTCCATTTTCTGTGTAGGGGAGTTGGGTTCCCAACCGTCTGAAACAAACGGAGACACATGAGCTCATAGACCACCTTGAACACCAGCGGATGGTGGTGA
TCACCACCATCCGCTGGTGTTCAAGGTGGTCTATGAGCTCATGTGTCTCCGTTTGTTTCAGACGGTTGGGAACCCAACTCCCCTACACAGAAAATGGAGC[G/A]
GTCCATTAGCGTGTGATTAATTAAGTATTTGCTAAAAAAAATTTCAAAATAGATTAATTTGATTCTTTAAGCAACTTTCGTATAGAAACTTTTTGCAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 38.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 57.20% | 42.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 83.20% | 16.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.70% | 59.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 67.10% | 32.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 68.60% | 31.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 50.50% | 49.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.20% | 30.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.10% | 34.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106608619 | C -> T | LOC_Os01g12120.1 | upstream_gene_variant ; 1380.0bp to feature; MODIFIER | silent_mutation | Average:51.036; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0106608619 | C -> T | LOC_Os01g12130.1 | downstream_gene_variant ; 3724.0bp to feature; MODIFIER | silent_mutation | Average:51.036; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0106608619 | C -> T | LOC_Os01g12120-LOC_Os01g12130 | intergenic_region ; MODIFIER | silent_mutation | Average:51.036; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106608619 | NA | 8.86E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | 5.38E-06 | 9.59E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 3.31E-10 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 7.51E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 3.43E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 1.88E-06 | mr1236_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 3.92E-07 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | 1.29E-08 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | 6.61E-11 | 8.04E-24 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 1.98E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 7.65E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | 2.35E-06 | NA | mr1951_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | 1.13E-07 | 1.83E-09 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106608619 | NA | 5.50E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |