Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106352079:

Variant ID: vg0106352079 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6352079
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TCCACGATTTGCAACTGATTTTATCACGTTCTAAAATATGCCATCATCTTTTGCTTAACTTCTATGATTTACCATCGCCGTCCAGTTAGTCTCCGTTAGT[A/G]
CTGTACAAATTTATCGAAATGACCAAAATACCCCTAGGATAAAACCTTTCAAAATGTGGATAAAAATTTTAAAATATCAGATTTTAAGTTTTTGGCTAAA

Reverse complement sequence

TTTAGCCAAAAACTTAAAATCTGATATTTTAAAATTTTTATCCACATTTTGAAAGGTTTTATCCTAGGGGTATTTTGGTCATTTCGATAAATTTGTACAG[T/C]
ACTAACGGAGACTAACTGGACGGCGATGGTAAATCATAGAAGTTAAGCAAAAGATGATGGCATATTTTAGAACGTGATAAAATCAGTTGCAAATCGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	48.60%	0.04%	0.40%	NA
All Indica	2759	18.50%	80.80%	0.04%	0.69%	NA
All Japonica	1512	98.50%	1.40%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	10.40%	89.40%	0.17%	0.00%	NA
Indica II	465	22.40%	77.60%	0.00%	0.00%	NA
Indica III	913	8.00%	90.00%	0.00%	1.97%	NA
Indica Intermediate	786	34.60%	65.30%	0.00%	0.13%	NA
Temperate Japonica	767	98.60%	1.30%	0.13%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	53.30%	46.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106352079	A -> G	LOC_Os01g11740.1	upstream_gene_variant ; 503.0bp to feature; MODIFIER	silent_mutation	Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0106352079	A -> G	LOC_Os01g11730-LOC_Os01g11740	intergenic_region ; MODIFIER	silent_mutation	Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N
vg0106352079	A -> DEL	N	N	silent_mutation	Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106352079	NA	4.13E-11	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	2.72E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	1.80E-06	NA	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	6.40E-06	3.25E-06	mr1207	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	2.77E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	6.08E-07	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	5.14E-09	1.80E-10	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	4.86E-21	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	7.97E-09	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	3.85E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	4.70E-06	8.77E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	3.67E-18	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	7.12E-06	1.54E-06	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	1.86E-25	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	8.22E-06	mr1943	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	5.25E-06	NA	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	5.39E-07	NA	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	1.22E-07	1.39E-12	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	5.40E-08	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	9.38E-09	6.68E-12	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	4.90E-06	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	7.77E-09	3.12E-15	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	4.56E-25	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	3.05E-08	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	1.24E-06	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	1.02E-08	8.03E-38	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	1.96E-08	1.95E-13	mr1943_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079	NA	1.64E-07	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251