Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106352079:

Variant ID: vg0106352079 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6352079
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TCCACGATTTGCAACTGATTTTATCACGTTCTAAAATATGCCATCATCTTTTGCTTAACTTCTATGATTTACCATCGCCGTCCAGTTAGTCTCCGTTAGT[A/G]
CTGTACAAATTTATCGAAATGACCAAAATACCCCTAGGATAAAACCTTTCAAAATGTGGATAAAAATTTTAAAATATCAGATTTTAAGTTTTTGGCTAAA

Reverse complement sequence

TTTAGCCAAAAACTTAAAATCTGATATTTTAAAATTTTTATCCACATTTTGAAAGGTTTTATCCTAGGGGTATTTTGGTCATTTCGATAAATTTGTACAG[T/C]
ACTAACGGAGACTAACTGGACGGCGATGGTAAATCATAGAAGTTAAGCAAAAGATGATGGCATATTTTAGAACGTGATAAAATCAGTTGCAAATCGTGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 48.60% 0.04% 0.40% NA
All Indica  2759 18.50% 80.80% 0.04% 0.69% NA
All Japonica  1512 98.50% 1.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 10.40% 89.40% 0.17% 0.00% NA
Indica II  465 22.40% 77.60% 0.00% 0.00% NA
Indica III  913 8.00% 90.00% 0.00% 1.97% NA
Indica Intermediate  786 34.60% 65.30% 0.00% 0.13% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106352079 A -> G LOC_Os01g11740.1 upstream_gene_variant ; 503.0bp to feature; MODIFIER silent_mutation Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0106352079 A -> G LOC_Os01g11730-LOC_Os01g11740 intergenic_region ; MODIFIER silent_mutation Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0106352079 A -> DEL N N silent_mutation Average:30.229; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106352079 NA 4.13E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 2.72E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 1.80E-06 NA mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 6.40E-06 3.25E-06 mr1207 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 2.77E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 6.08E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 5.14E-09 1.80E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 4.86E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 7.97E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 3.85E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 4.70E-06 8.77E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 3.67E-18 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 7.12E-06 1.54E-06 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 1.86E-25 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 8.22E-06 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 5.25E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 5.39E-07 NA mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 1.22E-07 1.39E-12 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 5.40E-08 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 9.38E-09 6.68E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 4.90E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 7.77E-09 3.12E-15 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 4.56E-25 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 3.05E-08 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 1.24E-06 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 1.02E-08 8.03E-38 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 1.96E-08 1.95E-13 mr1943_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106352079 NA 1.64E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251