Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106177750:

Variant ID: vg0106177750 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6177750
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAGTTGTTTTTAGAAAAAGAGTTCAAATAAAATCAACTGCAAAAACAACAGCCTTTCCTTGAAGCCTGCATTAAACATCTATTTTCCCTTGGCTTGCT[G/A]
AGTACTCCCGTACTTACCCTTGCTCTATATAAATAATTCCCCCCCCCCCAGTTGCTGAAGAAGATGAAGCGGATCCTGCTGATGAGGAGTTCTTTCAGGA

Reverse complement sequence

TCCTGAAAGAACTCCTCATCAGCAGGATCCGCTTCATCTTCTTCAGCAACTGGGGGGGGGGGAATTATTTATATAGAGCAAGGGTAAGTACGGGAGTACT[C/T]
AGCAAGCCAAGGGAAAATAGATGTTTAATGCAGGCTTCAAGGAAAGGCTGTTGTTTTTGCAGTTGATTTTATTTGAACTCTTTTTCTAAAAACAACTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.40%	2.10%	12.40%	41.11%	NA
All Indica	2759	39.60%	0.00%	11.71%	48.64%	NA
All Japonica	1512	60.30%	5.80%	5.36%	28.64%	NA
Aus	269	8.20%	0.00%	49.07%	42.75%	NA
Indica I	595	28.60%	0.00%	3.36%	68.07%	NA
Indica II	465	17.00%	0.20%	18.06%	64.73%	NA
Indica III	913	63.00%	0.00%	11.72%	25.30%	NA
Indica Intermediate	786	34.20%	0.00%	14.25%	51.53%	NA
Temperate Japonica	767	85.00%	8.00%	3.39%	3.65%	NA
Tropical Japonica	504	35.70%	0.60%	5.95%	57.74%	NA
Japonica Intermediate	241	32.80%	9.50%	10.37%	47.30%	NA
VI/Aromatic	96	32.30%	12.50%	32.29%	22.92%	NA
Intermediate	90	43.30%	1.10%	21.11%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106177750	G -> A	LOC_Os01g11460.1	upstream_gene_variant ; 4564.0bp to feature; MODIFIER	silent_mutation	Average:12.771; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0106177750	G -> A	LOC_Os01g11470.1	upstream_gene_variant ; 4413.0bp to feature; MODIFIER	silent_mutation	Average:12.771; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0106177750	G -> A	LOC_Os01g11460-LOC_Os01g11470	intergenic_region ; MODIFIER	silent_mutation	Average:12.771; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0106177750	G -> DEL	N	N	silent_mutation	Average:12.771; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106177750	1.67E-06	1.67E-06	mr1038	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	6.07E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	4.17E-06	4.17E-06	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	2.35E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	2.15E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	4.98E-06	4.98E-06	mr1389	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	1.37E-06	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	8.23E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	2.62E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	5.26E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106177750	NA	3.80E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251