\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106064420:

Variant ID: vg0106064420 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6064420
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGCACAAATGTAAATGCGACAATCAAATGAGACAATGAGACAAGAGATTTTTCACCGAGGTTCGAGAACTCGCCGGTTTCCTACTCCCCGTTGAGGC[A/G]
AGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCACGGAGAGGACTACCCAAGCCTC

Reverse complement sequence

GAGGCTTGGGTAGTCCTCTCCGTGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCT[T/C]
GCCTCAACGGGGAGTAGGAAACCGGCGAGTTCTCGAACCTCGGTGAAAAATCTCTTGTCTCATTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 26.20% 2.39% 11.38% NA
All Indica  2759 61.80% 16.20% 2.79% 19.14% NA
All Japonica  1512 65.10% 33.40% 1.26% 0.20% NA
Aus  269 4.10% 91.80% 4.09% 0.00% NA
Indica I  595 91.80% 7.90% 0.00% 0.34% NA
Indica II  465 63.90% 21.30% 1.08% 13.76% NA
Indica III  913 46.10% 7.60% 4.71% 41.62% NA
Indica Intermediate  786 56.20% 29.60% 3.69% 10.43% NA
Temperate Japonica  767 95.70% 4.20% 0.13% 0.00% NA
Tropical Japonica  504 30.20% 66.50% 2.98% 0.40% NA
Japonica Intermediate  241 41.10% 57.30% 1.24% 0.41% NA
VI/Aromatic  96 82.30% 16.70% 1.04% 0.00% NA
Intermediate  90 60.00% 26.70% 5.56% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106064420 A -> G LOC_Os01g11310.1 upstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0106064420 A -> G LOC_Os01g11330.1 upstream_gene_variant ; 4378.0bp to feature; MODIFIER silent_mutation Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0106064420 A -> G LOC_Os01g11320.1 downstream_gene_variant ; 1263.0bp to feature; MODIFIER silent_mutation Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0106064420 A -> G LOC_Os01g11310-LOC_Os01g11320 intergenic_region ; MODIFIER silent_mutation Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N
vg0106064420 A -> DEL N N silent_mutation Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106064420 NA 6.96E-10 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 4.17E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 5.95E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 2.50E-09 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 5.78E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 1.82E-10 3.77E-12 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 1.83E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 6.33E-06 NA mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 2.92E-15 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 NA 1.41E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106064420 4.44E-07 1.46E-07 mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251