| Variant ID: vg0106064420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6064420 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 92. )
AATTGCACAAATGTAAATGCGACAATCAAATGAGACAATGAGACAAGAGATTTTTCACCGAGGTTCGAGAACTCGCCGGTTTCCTACTCCCCGTTGAGGC[A/G]
AGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCACGGAGAGGACTACCCAAGCCTC
GAGGCTTGGGTAGTCCTCTCCGTGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCT[T/C]
GCCTCAACGGGGAGTAGGAAACCGGCGAGTTCTCGAACCTCGGTGAAAAATCTCTTGTCTCATTGTCTCATTTGATTGTCGCATTTACATTTGTGCAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 26.20% | 2.39% | 11.38% | NA |
| All Indica | 2759 | 61.80% | 16.20% | 2.79% | 19.14% | NA |
| All Japonica | 1512 | 65.10% | 33.40% | 1.26% | 0.20% | NA |
| Aus | 269 | 4.10% | 91.80% | 4.09% | 0.00% | NA |
| Indica I | 595 | 91.80% | 7.90% | 0.00% | 0.34% | NA |
| Indica II | 465 | 63.90% | 21.30% | 1.08% | 13.76% | NA |
| Indica III | 913 | 46.10% | 7.60% | 4.71% | 41.62% | NA |
| Indica Intermediate | 786 | 56.20% | 29.60% | 3.69% | 10.43% | NA |
| Temperate Japonica | 767 | 95.70% | 4.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 30.20% | 66.50% | 2.98% | 0.40% | NA |
| Japonica Intermediate | 241 | 41.10% | 57.30% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 82.30% | 16.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 26.70% | 5.56% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106064420 | A -> G | LOC_Os01g11310.1 | upstream_gene_variant ; 486.0bp to feature; MODIFIER | silent_mutation | Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064420 | A -> G | LOC_Os01g11330.1 | upstream_gene_variant ; 4378.0bp to feature; MODIFIER | silent_mutation | Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064420 | A -> G | LOC_Os01g11320.1 | downstream_gene_variant ; 1263.0bp to feature; MODIFIER | silent_mutation | Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064420 | A -> G | LOC_Os01g11310-LOC_Os01g11320 | intergenic_region ; MODIFIER | silent_mutation | Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0106064420 | A -> DEL | N | N | silent_mutation | Average:11.776; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106064420 | NA | 6.96E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 4.17E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 5.95E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 2.50E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 5.78E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | 1.82E-10 | 3.77E-12 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 1.83E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | 6.33E-06 | NA | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 2.92E-15 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | NA | 1.41E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106064420 | 4.44E-07 | 1.46E-07 | mr1951_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |