Variant ID: vg0105866541 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 5866541 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, others allele: 0.00, population size: 86. )
CCGACGGGAAGAGAAAGAGAGATAAGGGAGAGAGAGGGAGGCAGAAAGGTTGGAAAGAGAATGACATGTGGACCCCGCAAGTCAGTGGATCCTATTATAA[T/C]
TTTTGTGTGTGAATGACAAATTGGTCCCACATATATATTTTTAAATCTAATCTTACATCAGTGCCACGTCAACGCCACATGGGACGAAGACCAAGTCAAC
GTTGACTTGGTCTTCGTCCCATGTGGCGTTGACGTGGCACTGATGTAAGATTAGATTTAAAAATATATATGTGGGACCAATTTGTCATTCACACACAAAA[A/G]
TTATAATAGGATCCACTGACTTGCGGGGTCCACATGTCATTCTCTTTCCAACCTTTCTGCCTCCCTCTCTCTCCCTTATCTCTCTTTCTCTTCCCGTCGG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 75.60% | 24.40% | 0.02% | 0.00% | NA |
All Indica | 2759 | 69.00% | 31.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
Aus | 269 | 4.80% | 95.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 46.10% | 53.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0105866541 | T -> C | LOC_Os01g10990.1 | downstream_gene_variant ; 2747.0bp to feature; MODIFIER | silent_mutation | Average:55.625; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
vg0105866541 | T -> C | LOC_Os01g11000.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.625; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0105866541 | NA | 4.46E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 5.27E-07 | NA | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 8.67E-09 | 3.73E-15 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 3.14E-06 | NA | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 1.61E-06 | 3.50E-13 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 6.25E-07 | NA | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | 2.79E-08 | 1.07E-12 | mr1951 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105866541 | NA | 3.54E-10 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |