\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105785581:

Variant ID: vg0105785581 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5785581
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTATATTGATATTTTTTTTGGTTTGGAGAATTTGGAGGGGTATACTCACTATCTCTAATGAAAGGATGATTGCAACCACTTATTCATCCCACTCCCC[C/T]
AACCAAAAAAAAATTAGATCACCATATCCACTTTCATCCCTGCAACCAAACAAAAAACTGGATCGCCATATTTACTCCACCATACAAAAAACCGAATCGC

Reverse complement sequence

GCGATTCGGTTTTTTGTATGGTGGAGTAAATATGGCGATCCAGTTTTTTGTTTGGTTGCAGGGATGAAAGTGGATATGGTGATCTAATTTTTTTTTGGTT[G/A]
GGGGAGTGGGATGAATAAGTGGTTGCAATCATCCTTTCATTAGAGATAGTGAGTATACCCCTCCAAATTCTCCAAACCAAAAAAAATATCAATATACTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 11.40% 0.00% 0.00% NA
All Indica  2759 91.90% 8.10% 0.00% 0.00% NA
All Japonica  1512 79.70% 20.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 71.00% 29.00% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 53.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105785581 C -> T LOC_Os01g10850.1 upstream_gene_variant ; 3728.0bp to feature; MODIFIER silent_mutation Average:73.208; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0105785581 C -> T LOC_Os01g10840-LOC_Os01g10850 intergenic_region ; MODIFIER silent_mutation Average:73.208; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105785581 NA 1.02E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 5.20E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 2.73E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 2.28E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 3.40E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 2.81E-06 2.81E-06 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 3.11E-07 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 1.40E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 2.72E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 4.07E-06 4.07E-06 mr1264_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 3.91E-06 mr1437_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 3.05E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 1.47E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 7.72E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 1.99E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 3.58E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 9.95E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105785581 NA 9.22E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251