\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105779349:

Variant ID: vg0105779349 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5779349
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAAATAAAGAAGAATAGAGATGTAGTACATCTTTAGCATGAATTTTATAGATGCTTAGTTGGTATATTTCAACAACGGTTACATAGTAATATTTATAT[T/C]
AACATGTGGTTTTATCTGTTTCATCATGATTGTTTCTTTCTTAAGGTTGTATCAGGATAAAAAGTTGGGGCTGAAAATAGTCAGGAGGAATAGAAATGTG

Reverse complement sequence

CACATTTCTATTCCTCCTGACTATTTTCAGCCCCAACTTTTTATCCTGATACAACCTTAAGAAAGAAACAATCATGATGAAACAGATAAAACCACATGTT[A/G]
ATATAAATATTACTATGTAACCGTTGTTGAAATATACCAACTAAGCATCTATAAAATTCATGCTAAAGATGTACTACATCTCTATTCTTCTTTATTTATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 13.50% 0.72% 7.41% NA
All Indica  2759 84.30% 8.10% 0.58% 7.00% NA
All Japonica  1512 79.80% 9.10% 0.93% 10.25% NA
Aus  269 6.30% 92.20% 1.49% 0.00% NA
Indica I  595 90.90% 0.00% 0.84% 8.24% NA
Indica II  465 78.50% 21.10% 0.43% 0.00% NA
Indica III  913 93.10% 5.60% 0.11% 1.20% NA
Indica Intermediate  786 72.50% 9.50% 1.02% 16.92% NA
Temperate Japonica  767 95.80% 2.90% 0.26% 1.04% NA
Tropical Japonica  504 71.20% 6.00% 1.19% 21.63% NA
Japonica Intermediate  241 46.50% 35.30% 2.49% 15.77% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105779349 T -> DEL N N silent_mutation Average:22.75; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0105779349 T -> C LOC_Os01g10840.1 upstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:22.75; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0105779349 T -> C LOC_Os01g10840-LOC_Os01g10850 intergenic_region ; MODIFIER silent_mutation Average:22.75; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105779349 NA 5.82E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 2.48E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 1.17E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 1.58E-07 NA mr1951 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 9.36E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 8.11E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 3.76E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 2.04E-09 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 1.08E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 6.15E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 1.39E-07 9.64E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 4.11E-12 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 9.46E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 8.27E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 7.02E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 2.87E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105779349 NA 2.48E-06 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251