\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105752606:

Variant ID: vg0105752606 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5752606
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGAACTAAACACAGCTTTATTATGCTAGCAAAAGATCGATTTTCACTGACAAGATCAATCGTTTTATAATCTTAGGGGCTGTTAACAGTGAAATTT[G/A]
GTAAGCCCGGAGTAGTCACCGGCTTATAGTCAGCATCAGCTTCGAAGTCCTGAGATTAGCCGATGAGAGTTGTCAAGTCGTCAGTTGTCGGATTCTTGCT

Reverse complement sequence

AGCAAGAATCCGACAACTGACGACTTGACAACTCTCATCGGCTAATCTCAGGACTTCGAAGCTGATGCTGACTATAAGCCGGTGACTACTCCGGGCTTAC[C/T]
AAATTTCACTGTTAACAGCCCCTAAGATTATAAAACGATTGATCTTGTCAGTGAAAATCGATCTTTTGCTAGCATAATAAAGCTGTGTTTAGTTCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 4.40% 6.24% 16.72% NA
All Indica  2759 62.50% 5.90% 9.53% 22.11% NA
All Japonica  1512 88.80% 0.20% 1.12% 9.85% NA
Aus  269 77.70% 10.00% 3.72% 8.55% NA
Indica I  595 19.50% 0.00% 21.85% 58.66% NA
Indica II  465 71.60% 21.50% 1.94% 4.95% NA
Indica III  913 87.40% 1.60% 5.48% 5.48% NA
Indica Intermediate  786 60.60% 6.10% 9.41% 23.92% NA
Temperate Japonica  767 98.70% 0.10% 0.00% 1.17% NA
Tropical Japonica  504 77.40% 0.00% 3.37% 19.25% NA
Japonica Intermediate  241 81.30% 0.80% 0.00% 17.84% NA
VI/Aromatic  96 83.30% 13.50% 1.04% 2.08% NA
Intermediate  90 84.40% 4.40% 4.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105752606 G -> A LOC_Os01g10740.1 upstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0105752606 G -> A LOC_Os01g10760.1 upstream_gene_variant ; 1571.0bp to feature; MODIFIER silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0105752606 G -> A LOC_Os01g10750.1 downstream_gene_variant ; 2171.0bp to feature; MODIFIER silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0105752606 G -> A LOC_Os01g10770.1 downstream_gene_variant ; 4885.0bp to feature; MODIFIER silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0105752606 G -> A LOC_Os01g10760-LOC_Os01g10770 intergenic_region ; MODIFIER silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0105752606 G -> DEL N N silent_mutation Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105752606 NA 3.53E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 9.77E-10 1.75E-19 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 7.72E-12 1.80E-26 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 NA 3.81E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 7.04E-11 8.11E-25 mr1769 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 5.07E-13 2.04E-30 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 NA 6.07E-12 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 1.59E-06 9.72E-12 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 1.28E-09 7.54E-19 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 2.40E-11 1.65E-21 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 NA 9.29E-08 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 9.19E-06 2.26E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 5.88E-09 3.73E-19 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 2.28E-09 6.44E-20 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 5.56E-09 3.67E-20 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 9.28E-12 4.35E-29 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 NA 2.09E-06 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 3.07E-06 2.39E-10 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 2.07E-07 2.47E-11 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 5.41E-07 7.48E-12 mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606 5.88E-08 5.95E-16 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251