Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105752606:

Variant ID: vg0105752606 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5752606
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGGGAACTAAACACAGCTTTATTATGCTAGCAAAAGATCGATTTTCACTGACAAGATCAATCGTTTTATAATCTTAGGGGCTGTTAACAGTGAAATTT[G/A]
GTAAGCCCGGAGTAGTCACCGGCTTATAGTCAGCATCAGCTTCGAAGTCCTGAGATTAGCCGATGAGAGTTGTCAAGTCGTCAGTTGTCGGATTCTTGCT

Reverse complement sequence

AGCAAGAATCCGACAACTGACGACTTGACAACTCTCATCGGCTAATCTCAGGACTTCGAAGCTGATGCTGACTATAAGCCGGTGACTACTCCGGGCTTAC[C/T]
AAATTTCACTGTTAACAGCCCCTAAGATTATAAAACGATTGATCTTGTCAGTGAAAATCGATCTTTTGCTAGCATAATAAAGCTGTGTTTAGTTCCCTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	4.40%	6.24%	16.72%	NA
All Indica	2759	62.50%	5.90%	9.53%	22.11%	NA
All Japonica	1512	88.80%	0.20%	1.12%	9.85%	NA
Aus	269	77.70%	10.00%	3.72%	8.55%	NA
Indica I	595	19.50%	0.00%	21.85%	58.66%	NA
Indica II	465	71.60%	21.50%	1.94%	4.95%	NA
Indica III	913	87.40%	1.60%	5.48%	5.48%	NA
Indica Intermediate	786	60.60%	6.10%	9.41%	23.92%	NA
Temperate Japonica	767	98.70%	0.10%	0.00%	1.17%	NA
Tropical Japonica	504	77.40%	0.00%	3.37%	19.25%	NA
Japonica Intermediate	241	81.30%	0.80%	0.00%	17.84%	NA
VI/Aromatic	96	83.30%	13.50%	1.04%	2.08%	NA
Intermediate	90	84.40%	4.40%	4.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105752606	G -> A	LOC_Os01g10740.1	upstream_gene_variant ; 3336.0bp to feature; MODIFIER	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0105752606	G -> A	LOC_Os01g10760.1	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0105752606	G -> A	LOC_Os01g10750.1	downstream_gene_variant ; 2171.0bp to feature; MODIFIER	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0105752606	G -> A	LOC_Os01g10770.1	downstream_gene_variant ; 4885.0bp to feature; MODIFIER	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0105752606	G -> A	LOC_Os01g10760-LOC_Os01g10770	intergenic_region ; MODIFIER	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0105752606	G -> DEL	N	N	silent_mutation	Average:32.174; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105752606	NA	3.53E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	9.77E-10	1.75E-19	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	7.72E-12	1.80E-26	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	NA	3.81E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	7.04E-11	8.11E-25	mr1769	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	5.07E-13	2.04E-30	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	NA	6.07E-12	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	1.59E-06	9.72E-12	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	1.28E-09	7.54E-19	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	2.40E-11	1.65E-21	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	NA	9.29E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	9.19E-06	2.26E-11	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	5.88E-09	3.73E-19	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	2.28E-09	6.44E-20	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	5.56E-09	3.67E-20	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	9.28E-12	4.35E-29	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	NA	2.09E-06	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	3.07E-06	2.39E-10	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	2.07E-07	2.47E-11	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	5.41E-07	7.48E-12	mr1951_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105752606	5.88E-08	5.95E-16	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251