\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105735724:

Variant ID: vg0105735724 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5735724
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCCCCCACCCACCCCCCCCCCCCCCCAAAAAAAAAAGCTCAGAGATGCCCACTCTCCACTTTTCAGTCTAATTCAACATTTATCAGAAAAAGGGTATA[A/G]
TATTTGATTCCATCCATAAATCGACTTTCCCTCCTATGCTCTAAGTTCCAGTATTGATAAGAATTCGAGTTCTTAATGTTCGTATGGTGTAAATTGGGAA

Reverse complement sequence

TTCCCAATTTACACCATACGAACATTAAGAACTCGAATTCTTATCAATACTGGAACTTAGAGCATAGGAGGGAAAGTCGATTTATGGATGGAATCAAATA[T/C]
TATACCCTTTTTCTGATAAATGTTGAATTAGACTGAAAAGTGGAGAGTGGGCATCTCTGAGCTTTTTTTTTTGGGGGGGGGGGGGGGTGGGTGGGGGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.40% 0.06% 0.00% NA
All Indica  2759 51.40% 48.60% 0.04% 0.00% NA
All Japonica  1512 88.00% 12.00% 0.00% 0.00% NA
Aus  269 5.20% 94.10% 0.74% 0.00% NA
Indica I  595 10.40% 89.60% 0.00% 0.00% NA
Indica II  465 61.50% 38.50% 0.00% 0.00% NA
Indica III  913 73.60% 26.40% 0.00% 0.00% NA
Indica Intermediate  786 50.50% 49.40% 0.13% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 75.40% 24.60% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105735724 A -> G LOC_Os01g10710.1 downstream_gene_variant ; 1404.0bp to feature; MODIFIER silent_mutation Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg0105735724 A -> G LOC_Os01g10720.1 downstream_gene_variant ; 575.0bp to feature; MODIFIER silent_mutation Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N
vg0105735724 A -> G LOC_Os01g10710-LOC_Os01g10720 intergenic_region ; MODIFIER silent_mutation Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105735724 NA 7.96E-10 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.58E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 9.95E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.45E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.04E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 5.93E-06 NA mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.21E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 7.15E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.00E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.04E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 2.41E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.34E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 3.28E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.10E-10 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 4.98E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 4.71E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 6.50E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.46E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 7.04E-09 mr1785_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 4.60E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 2.37E-13 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 3.73E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.57E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 7.65E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.16E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 3.23E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 1.52E-20 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724 NA 3.01E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251