Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105735724:

Variant ID: vg0105735724 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5735724
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCCCCCACCCACCCCCCCCCCCCCCCAAAAAAAAAAGCTCAGAGATGCCCACTCTCCACTTTTCAGTCTAATTCAACATTTATCAGAAAAAGGGTATA[A/G]
TATTTGATTCCATCCATAAATCGACTTTCCCTCCTATGCTCTAAGTTCCAGTATTGATAAGAATTCGAGTTCTTAATGTTCGTATGGTGTAAATTGGGAA

Reverse complement sequence

TTCCCAATTTACACCATACGAACATTAAGAACTCGAATTCTTATCAATACTGGAACTTAGAGCATAGGAGGGAAAGTCGATTTATGGATGGAATCAAATA[T/C]
TATACCCTTTTTCTGATAAATGTTGAATTAGACTGAAAAGTGGAGAGTGGGCATCTCTGAGCTTTTTTTTTTGGGGGGGGGGGGGGGTGGGTGGGGGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	38.40%	0.06%	0.00%	NA
All Indica	2759	51.40%	48.60%	0.04%	0.00%	NA
All Japonica	1512	88.00%	12.00%	0.00%	0.00%	NA
Aus	269	5.20%	94.10%	0.74%	0.00%	NA
Indica I	595	10.40%	89.60%	0.00%	0.00%	NA
Indica II	465	61.50%	38.50%	0.00%	0.00%	NA
Indica III	913	73.60%	26.40%	0.00%	0.00%	NA
Indica Intermediate	786	50.50%	49.40%	0.13%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	75.40%	24.60%	0.00%	0.00%	NA
Japonica Intermediate	241	80.90%	19.10%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105735724	A -> G	LOC_Os01g10710.1	downstream_gene_variant ; 1404.0bp to feature; MODIFIER	silent_mutation	Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466	N	N	N	N
vg0105735724	A -> G	LOC_Os01g10720.1	downstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466	N	N	N	N
vg0105735724	A -> G	LOC_Os01g10710-LOC_Os01g10720	intergenic_region ; MODIFIER	silent_mutation	Average:53.314; most accessible tissue: Zhenshan97 root, score: 74.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105735724	NA	7.96E-10	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.58E-06	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	9.95E-07	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.45E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.04E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	5.93E-06	NA	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.21E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	7.15E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.00E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.04E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	2.41E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.34E-08	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	3.28E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.10E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	4.98E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	4.71E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	6.50E-07	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.46E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	7.04E-09	mr1785_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	4.60E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	2.37E-13	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	3.73E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.57E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	7.65E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.16E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	3.23E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	1.52E-20	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105735724	NA	3.01E-07	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251