\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105681296:

Variant ID: vg0105681296 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5681296
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCACATCGAATCTTTGAATACATGTATTAAGCATTAAATATAGATAAAGAAAAAATAATTGCACAGTTTGCATGTAAATCGCGAGACGAATCTTTTGA[A/G]
TCTAATTAGTCCATGATTAACCATAAGTATTACAGTAACCCACATGTGCTAATGATGGCTTAATTAGGCTCAAAGGATTCGTCTCGTGGTTTACATGCGA

Reverse complement sequence

TCGCATGTAAACCACGAGACGAATCCTTTGAGCCTAATTAAGCCATCATTAGCACATGTGGGTTACTGTAATACTTATGGTTAATCATGGACTAATTAGA[T/C]
TCAAAAGATTCGTCTCGCGATTTACATGCAAACTGTGCAATTATTTTTTCTTTATCTATATTTAATGCTTAATACATGTATTCAAAGATTCGATGTGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 38.20% 0.00% 0.00% NA
All Indica  2759 88.30% 11.70% 0.00% 0.00% NA
All Japonica  1512 10.40% 89.60% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 77.40% 22.60% 0.00% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 81.90% 18.10% 0.00% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 19.60% 80.40% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105681296 A -> G LOC_Os01g10630.1 upstream_gene_variant ; 1745.0bp to feature; MODIFIER silent_mutation Average:56.61; most accessible tissue: Callus, score: 73.724 N N N N
vg0105681296 A -> G LOC_Os01g10640.1 upstream_gene_variant ; 4298.0bp to feature; MODIFIER silent_mutation Average:56.61; most accessible tissue: Callus, score: 73.724 N N N N
vg0105681296 A -> G LOC_Os01g10630.2 upstream_gene_variant ; 1745.0bp to feature; MODIFIER silent_mutation Average:56.61; most accessible tissue: Callus, score: 73.724 N N N N
vg0105681296 A -> G LOC_Os01g10630-LOC_Os01g10640 intergenic_region ; MODIFIER silent_mutation Average:56.61; most accessible tissue: Callus, score: 73.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105681296 NA 1.49E-07 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 8.07E-07 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 1.68E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 2.89E-12 9.85E-17 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 4.60E-11 1.29E-26 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 1.43E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 1.02E-11 6.46E-27 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 4.64E-07 2.85E-07 mr1795 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 3.60E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 7.54E-06 mr1881 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 3.38E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 6.42E-08 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 1.01E-06 4.70E-12 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 7.31E-08 1.13E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 3.81E-11 4.25E-21 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 NA 1.57E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 3.87E-06 2.89E-11 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 2.65E-09 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 2.56E-10 7.67E-21 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 1.76E-12 1.03E-27 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 7.51E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 3.77E-06 2.86E-08 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 7.66E-09 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 1.93E-06 1.33E-10 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296 6.45E-08 2.76E-15 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251