Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105681296:

Variant ID: vg0105681296 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5681296
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCACATCGAATCTTTGAATACATGTATTAAGCATTAAATATAGATAAAGAAAAAATAATTGCACAGTTTGCATGTAAATCGCGAGACGAATCTTTTGA[A/G]
TCTAATTAGTCCATGATTAACCATAAGTATTACAGTAACCCACATGTGCTAATGATGGCTTAATTAGGCTCAAAGGATTCGTCTCGTGGTTTACATGCGA

Reverse complement sequence

TCGCATGTAAACCACGAGACGAATCCTTTGAGCCTAATTAAGCCATCATTAGCACATGTGGGTTACTGTAATACTTATGGTTAATCATGGACTAATTAGA[T/C]
TCAAAAGATTCGTCTCGCGATTTACATGCAAACTGTGCAATTATTTTTTCTTTATCTATATTTAATGCTTAATACATGTATTCAAAGATTCGATGTGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	38.20%	0.00%	0.00%	NA
All Indica	2759	88.30%	11.70%	0.00%	0.00%	NA
All Japonica	1512	10.40%	89.60%	0.00%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	92.10%	7.90%	0.00%	0.00%	NA
Indica II	465	77.40%	22.60%	0.00%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	81.90%	18.10%	0.00%	0.00%	NA
Temperate Japonica	767	2.30%	97.70%	0.00%	0.00%	NA
Tropical Japonica	504	19.60%	80.40%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.40%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105681296	A -> G	LOC_Os01g10630.1	upstream_gene_variant ; 1745.0bp to feature; MODIFIER	silent_mutation	Average:56.61; most accessible tissue: Callus, score: 73.724	N	N	N	N
vg0105681296	A -> G	LOC_Os01g10640.1	upstream_gene_variant ; 4298.0bp to feature; MODIFIER	silent_mutation	Average:56.61; most accessible tissue: Callus, score: 73.724	N	N	N	N
vg0105681296	A -> G	LOC_Os01g10630.2	upstream_gene_variant ; 1745.0bp to feature; MODIFIER	silent_mutation	Average:56.61; most accessible tissue: Callus, score: 73.724	N	N	N	N
vg0105681296	A -> G	LOC_Os01g10630-LOC_Os01g10640	intergenic_region ; MODIFIER	silent_mutation	Average:56.61; most accessible tissue: Callus, score: 73.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105681296	NA	1.49E-07	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	8.07E-07	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	1.68E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	2.89E-12	9.85E-17	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	4.60E-11	1.29E-26	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	1.43E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	1.02E-11	6.46E-27	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	4.64E-07	2.85E-07	mr1795	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	3.60E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	7.54E-06	mr1881	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	3.38E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	6.42E-08	NA	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	1.01E-06	4.70E-12	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	7.31E-08	1.13E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	3.81E-11	4.25E-21	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	NA	1.57E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	3.87E-06	2.89E-11	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	2.65E-09	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	2.56E-10	7.67E-21	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	1.76E-12	1.03E-27	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	7.51E-06	NA	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	3.77E-06	2.86E-08	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	7.66E-09	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	1.93E-06	1.33E-10	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105681296	6.45E-08	2.76E-15	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251