\
| Variant ID: vg0105661905 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5661905 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 268. )
TTCAAATTATGTCTGATCTTTATTTTTCTAATTTAGCCTCAGATAACTTTTTTTGCACACTGCGCAAGTTCTAATTCATAATTACAAGTGGCTACAGCAC[T/G]
GACATCTCACTGTATGTACATCGATCTCAATTGAAGGTGATTTTGTTTTTGTTTTCTTTGAGATCAACTGTATGTATAATTCTGAATGTGCCTTTTTTGG
CCAAAAAAGGCACATTCAGAATTATACATACAGTTGATCTCAAAGAAAACAAAAACAAAATCACCTTCAATTGAGATCGATGTACATACAGTGAGATGTC[A/C]
GTGCTGTAGCCACTTGTAATTATGAATTAGAACTTGCGCAGTGTGCAAAAAAAGTTATCTGAGGCTAAATTAGAAAAATAAAGATCAGACATAATTTGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 31.70% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 79.90% | 19.90% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 43.90% | 55.20% | 0.93% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.50% | 42.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 21.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 60.40% | 37.90% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 21.60% | 78.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.20% | 61.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 75.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 32.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105661905 | T -> G | LOC_Os01g10600.1 | downstream_gene_variant ; 1418.0bp to feature; MODIFIER | silent_mutation | Average:40.406; most accessible tissue: Callus, score: 61.709 | N | N | N | N |
| vg0105661905 | T -> G | LOC_Os01g10590-LOC_Os01g10600 | intergenic_region ; MODIFIER | silent_mutation | Average:40.406; most accessible tissue: Callus, score: 61.709 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105661905 | 1.62E-09 | 1.65E-15 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 3.66E-12 | 1.29E-20 | mr1498 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 1.16E-08 | 1.52E-12 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 6.29E-07 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 2.03E-10 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 1.42E-07 | 3.70E-15 | mr1925 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 1.62E-10 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 6.52E-09 | 2.66E-14 | mr1951 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 3.78E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 6.10E-08 | 1.58E-16 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 2.40E-10 | 4.48E-19 | mr1498_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 2.31E-11 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 2.87E-09 | 3.60E-16 | mr1769_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 2.20E-06 | mr1795_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 1.66E-07 | 6.42E-11 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 3.67E-08 | 1.05E-15 | mr1925_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 5.72E-10 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | 8.85E-07 | 2.51E-14 | mr1951_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105661905 | NA | 3.25E-07 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |