Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0105467815:

Variant ID: vg0105467815 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5467815
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCATGTGGCATTCACATATGTTAATTAGAGTTCTTAACAATTAATTTAATATCCTAATTATATATGATTATTAAATTTTTTATTAATTTTAAATCATG[T/C]
CGTATGTATATACATATGTTAATTAGAGTTTTTAACAATTTAATATCATTCATATGCTAAGTATATATGATTATTAGAATTTTTATTAATTTTAAAACGT

Reverse complement sequence

ACGTTTTAAAATTAATAAAAATTCTAATAATCATATATACTTAGCATATGAATGATATTAAATTGTTAAAAACTCTAATTAACATATGTATATACATACG[A/G]
CATGATTTAAAATTAATAAAAAATTTAATAATCATATATAATTAGGATATTAAATTAATTGTTAAGAACTCTAATTAACATATGTGAATGCCACATGCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.20%	25.20%	12.95%	4.66%	NA
All Indica	2759	53.10%	21.90%	17.76%	7.21%	NA
All Japonica	1512	66.60%	30.70%	1.98%	0.73%	NA
Aus	269	37.90%	28.30%	31.60%	2.23%	NA
Indica I	595	24.90%	43.90%	25.88%	5.38%	NA
Indica II	465	34.00%	28.00%	21.29%	16.77%	NA
Indica III	913	84.20%	6.80%	6.90%	2.08%	NA
Indica Intermediate	786	49.70%	19.20%	22.14%	8.91%	NA
Temperate Japonica	767	45.90%	50.30%	2.48%	1.30%	NA
Tropical Japonica	504	96.00%	2.40%	1.39%	0.20%	NA
Japonica Intermediate	241	71.00%	27.40%	1.66%	0.00%	NA
VI/Aromatic	96	76.00%	21.90%	0.00%	2.08%	NA
Intermediate	90	61.10%	28.90%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105467815	T -> DEL	N	N	silent_mutation	Average:14.508; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0105467815	T -> C	LOC_Os01g10390.1	upstream_gene_variant ; 2304.0bp to feature; MODIFIER	silent_mutation	Average:14.508; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0105467815	T -> C	LOC_Os01g10380.1	downstream_gene_variant ; 373.0bp to feature; MODIFIER	silent_mutation	Average:14.508; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0105467815	T -> C	LOC_Os01g10380-LOC_Os01g10390	intergenic_region ; MODIFIER	silent_mutation	Average:14.508; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105467815	5.09E-06	2.45E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	8.31E-07	8.29E-07	mr1267	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	3.97E-06	mr1339	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	2.88E-10	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	7.65E-06	2.41E-06	mr1501	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	3.18E-07	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	4.73E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	7.13E-09	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	2.70E-07	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105467815	NA	1.11E-06	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251