\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105456852:

Variant ID: vg0105456852 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5456852
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TATCAAGCAAATGGTCATGAAAAATAATTTTGATTATGGTGTAATCCATATCTAAAAATTTGTTGCTTAAAATACAACTCGTATAAAGAAGGGAAAAACA[G/T]
AAATATTTCAAGCAAATGATCATGAAAAATAATTTTGATTATGGTGTAATCCATATCTAAAAATTTTCTGCTTAAAATACAACTTGTATAAAGAAGGAAA

Reverse complement sequence

TTTCCTTCTTTATACAAGTTGTATTTTAAGCAGAAAATTTTTAGATATGGATTACACCATAATCAAAATTATTTTTCATGATCATTTGCTTGAAATATTT[C/A]
TGTTTTTCCCTTCTTTATACGAGTTGTATTTTAAGCAACAAATTTTTAGATATGGATTACACCATAATCAAAATTATTTTTCATGACCATTTGCTTGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 13.50% 20.08% 2.37% NA
All Indica  2759 79.20% 7.20% 12.54% 1.09% NA
All Japonica  1512 38.50% 24.10% 33.27% 4.10% NA
Aus  269 60.20% 14.10% 21.56% 4.09% NA
Indica I  595 52.40% 13.60% 31.26% 2.69% NA
Indica II  465 97.40% 1.10% 1.51% 0.00% NA
Indica III  913 95.80% 2.00% 2.08% 0.11% NA
Indica Intermediate  786 69.20% 12.10% 17.05% 1.65% NA
Temperate Japonica  767 55.50% 14.10% 29.73% 0.65% NA
Tropical Japonica  504 14.10% 39.70% 36.90% 9.33% NA
Japonica Intermediate  241 35.30% 23.70% 36.93% 4.15% NA
VI/Aromatic  96 34.40% 30.20% 28.12% 7.29% NA
Intermediate  90 72.20% 8.90% 16.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105456852 G -> T LOC_Os01g10370.1 upstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:21.017; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0105456852 G -> T LOC_Os01g10370-LOC_Os01g10380 intergenic_region ; MODIFIER silent_mutation Average:21.017; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0105456852 G -> DEL N N silent_mutation Average:21.017; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105456852 NA 6.40E-07 mr1339 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 3.59E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 2.21E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 2.71E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 2.13E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 7.95E-06 7.93E-06 mr1452 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 4.57E-06 mr1513 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 4.90E-11 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 3.84E-11 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 7.97E-07 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 4.95E-06 4.94E-06 mr1694 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 1.26E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 1.35E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105456852 NA 2.77E-06 mr1460_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251