Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105278554:

Variant ID: vg0105278554 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 5278554
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTTATGAATACATGCCACTCTATACATTTAGTTCTTTCTTTCTAAAATATATATAAGAACCTATAGTATCGGATGGAACACTTTAGTTTTTATTACTA[C/T]
GACACATTTTTGTGACCGACTCTGGAATATATATAACTTTAAACTGATCAAATTAAACGGTTCAAAACTTTGTTGCTAAGTTGATTTTTTATAATTTTAA

Reverse complement sequence

TTAAAATTATAAAAAATCAACTTAGCAACAAAGTTTTGAACCGTTTAATTTGATCAGTTTAAAGTTATATATATTCCAGAGTCGGTCACAAAAATGTGTC[G/A]
TAGTAATAAAAACTAAAGTGTTCCATCCGATACTATAGGTTCTTATATATATTTTAGAAAGAAAGAACTAAATGTATAGAGTGGCATGTATTCATAAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	0.70%	2.98%	0.74%	NA
All Indica	2759	93.20%	1.00%	4.64%	1.16%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	95.20%	1.10%	2.97%	0.74%	NA
Indica I	595	85.00%	0.50%	12.77%	1.68%	NA
Indica II	465	94.80%	0.40%	2.80%	1.94%	NA
Indica III	913	97.40%	1.40%	0.99%	0.22%	NA
Indica Intermediate	786	93.50%	1.30%	3.82%	1.40%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	2.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0105278554	C -> T	LOC_Os01g10110.1	upstream_gene_variant ; 2876.0bp to feature; MODIFIER	silent_mutation	Average:49.758; most accessible tissue: Callus, score: 92.134	N	N	N	N
vg0105278554	C -> T	LOC_Os01g10120.1	upstream_gene_variant ; 2628.0bp to feature; MODIFIER	silent_mutation	Average:49.758; most accessible tissue: Callus, score: 92.134	N	N	N	N
vg0105278554	C -> T	LOC_Os01g10110-LOC_Os01g10120	intergenic_region ; MODIFIER	silent_mutation	Average:49.758; most accessible tissue: Callus, score: 92.134	N	N	N	N
vg0105278554	C -> DEL	N	N	silent_mutation	Average:49.758; most accessible tissue: Callus, score: 92.134	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0105278554	NA	1.56E-10	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	1.96E-18	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	3.71E-12	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	1.67E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.08E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	4.41E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	8.27E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	5.12E-23	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.73E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	7.91E-06	NA	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	6.26E-07	1.94E-06	mr1587	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	3.32E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	7.23E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	9.56E-06	mr1766	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.93E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.51E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.51E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	5.46E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554	NA	2.17E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251