\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105278554:

Variant ID: vg0105278554 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5278554
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTTATGAATACATGCCACTCTATACATTTAGTTCTTTCTTTCTAAAATATATATAAGAACCTATAGTATCGGATGGAACACTTTAGTTTTTATTACTA[C/T]
GACACATTTTTGTGACCGACTCTGGAATATATATAACTTTAAACTGATCAAATTAAACGGTTCAAAACTTTGTTGCTAAGTTGATTTTTTATAATTTTAA

Reverse complement sequence

TTAAAATTATAAAAAATCAACTTAGCAACAAAGTTTTGAACCGTTTAATTTGATCAGTTTAAAGTTATATATATTCCAGAGTCGGTCACAAAAATGTGTC[G/A]
TAGTAATAAAAACTAAAGTGTTCCATCCGATACTATAGGTTCTTATATATATTTTAGAAAGAAAGAACTAAATGTATAGAGTGGCATGTATTCATAAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 0.70% 2.98% 0.74% NA
All Indica  2759 93.20% 1.00% 4.64% 1.16% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 95.20% 1.10% 2.97% 0.74% NA
Indica I  595 85.00% 0.50% 12.77% 1.68% NA
Indica II  465 94.80% 0.40% 2.80% 1.94% NA
Indica III  913 97.40% 1.40% 0.99% 0.22% NA
Indica Intermediate  786 93.50% 1.30% 3.82% 1.40% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 94.40% 2.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105278554 C -> T LOC_Os01g10110.1 upstream_gene_variant ; 2876.0bp to feature; MODIFIER silent_mutation Average:49.758; most accessible tissue: Callus, score: 92.134 N N N N
vg0105278554 C -> T LOC_Os01g10120.1 upstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:49.758; most accessible tissue: Callus, score: 92.134 N N N N
vg0105278554 C -> T LOC_Os01g10110-LOC_Os01g10120 intergenic_region ; MODIFIER silent_mutation Average:49.758; most accessible tissue: Callus, score: 92.134 N N N N
vg0105278554 C -> DEL N N silent_mutation Average:49.758; most accessible tissue: Callus, score: 92.134 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105278554 NA 1.56E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 1.96E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 3.71E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 1.67E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.08E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 4.41E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 8.27E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 5.12E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.73E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 7.91E-06 NA mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 6.26E-07 1.94E-06 mr1587 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 3.32E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 7.23E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 9.56E-06 mr1766 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.93E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.51E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.51E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 5.46E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105278554 NA 2.17E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251