\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105207598:

Variant ID: vg0105207598 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5207598
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCTAATAAAGAATATTCTACTCCCTCCGTTTCACAATGTAAGTTATTCTAGCATTTTCCACATTCATATTGATGCTAATGAATCTATACATATATAC[C/A,T]
TATCTAGATTCATTAGTATCAATATAAATATGAGAAATGTTAGAATGACTTTCATTGTGAAACGGAGGAAGTATATGTGGAAACATGCGTGTACCATGGG

Reverse complement sequence

CCCATGGTACACGCATGTTTCCACATATACTTCCTCCGTTTCACAATGAAAGTCATTCTAACATTTCTCATATTTATATTGATACTAATGAATCTAGATA[G/T,A]
GTATATATGTATAGATTCATTAGCATCAATATGAATGTGGAAAATGCTAGAATAACTTACATTGTGAAACGGAGGGAGTAGAATATTCTTTATTAGATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 15.60% 0.34% 0.00% T: 0.02%
All Indica  2759 80.00% 19.40% 0.54% 0.00% NA
All Japonica  1512 99.00% 0.90% 0.00% 0.00% T: 0.07%
Aus  269 33.10% 66.50% 0.37% 0.00% NA
Indica I  595 46.60% 52.80% 0.67% 0.00% NA
Indica II  465 97.60% 1.70% 0.65% 0.00% NA
Indica III  913 97.80% 2.00% 0.22% 0.00% NA
Indica Intermediate  786 74.30% 24.90% 0.76% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.40% 2.40% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105207598 C -> T LOC_Os01g09990.1 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> T LOC_Os01g10000.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> T LOC_Os01g09990.2 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> T LOC_Os01g09990-LOC_Os01g10000 intergenic_region ; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> A LOC_Os01g09990.1 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> A LOC_Os01g10000.1 downstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> A LOC_Os01g09990.2 downstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N
vg0105207598 C -> A LOC_Os01g09990-LOC_Os01g10000 intergenic_region ; MODIFIER silent_mutation Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105207598 NA 2.65E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 1.65E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 1.35E-06 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 1.93E-10 mr1574 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 4.43E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 2.02E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 5.12E-06 mr1137_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 7.09E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 7.52E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 1.54E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105207598 NA 2.07E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251