| Variant ID: vg0105207598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 5207598 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCATCTAATAAAGAATATTCTACTCCCTCCGTTTCACAATGTAAGTTATTCTAGCATTTTCCACATTCATATTGATGCTAATGAATCTATACATATATAC[C/A,T]
TATCTAGATTCATTAGTATCAATATAAATATGAGAAATGTTAGAATGACTTTCATTGTGAAACGGAGGAAGTATATGTGGAAACATGCGTGTACCATGGG
CCCATGGTACACGCATGTTTCCACATATACTTCCTCCGTTTCACAATGAAAGTCATTCTAACATTTCTCATATTTATATTGATACTAATGAATCTAGATA[G/T,A]
GTATATATGTATAGATTCATTAGCATCAATATGAATGTGGAAAATGCTAGAATAACTTACATTGTGAAACGGAGGGAGTAGAATATTCTTTATTAGATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.10% | 15.60% | 0.34% | 0.00% | T: 0.02% |
| All Indica | 2759 | 80.00% | 19.40% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 99.00% | 0.90% | 0.00% | 0.00% | T: 0.07% |
| Aus | 269 | 33.10% | 66.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 46.60% | 52.80% | 0.67% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.70% | 0.65% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 74.30% | 24.90% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.40% | 0.00% | 0.00% | T: 0.20% |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0105207598 | C -> T | LOC_Os01g09990.1 | downstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> T | LOC_Os01g10000.1 | downstream_gene_variant ; 2870.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> T | LOC_Os01g09990.2 | downstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> T | LOC_Os01g09990-LOC_Os01g10000 | intergenic_region ; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> A | LOC_Os01g09990.1 | downstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> A | LOC_Os01g10000.1 | downstream_gene_variant ; 2870.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> A | LOC_Os01g09990.2 | downstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| vg0105207598 | C -> A | LOC_Os01g09990-LOC_Os01g10000 | intergenic_region ; MODIFIER | silent_mutation | Average:31.116; most accessible tissue: Minghui63 flower, score: 52.791 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0105207598 | NA | 2.65E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 1.65E-06 | mr1485 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 1.35E-06 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 1.93E-10 | mr1574 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 4.43E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 2.02E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 5.12E-06 | mr1137_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 7.09E-09 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 7.52E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 1.54E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0105207598 | NA | 2.07E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |