\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0105205537:

Variant ID: vg0105205537 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 5205537
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTACCATGTTAGTTTGCTCATCTGCAGAATGGTATTTTAACGAAACCCACTTTTGACAATAGCGTAGTCTCAATTTGCCCGTAGTCCGTCTAGGCTCA[T/C]
GTGAATTATTCATCGAAATTATATATAATTAAAAAATAAAAAAAATTATAAATATTGTTTATACGTCATGTTTGATACAACTCCACATCTTAAATTTGCG

Reverse complement sequence

CGCAAATTTAAGATGTGGAGTTGTATCAAACATGACGTATAAACAATATTTATAATTTTTTTTATTTTTTAATTATATATAATTTCGATGAATAATTCAC[A/G]
TGAGCCTAGACGGACTACGGGCAAATTGAGACTACGCTATTGTCAAAAGTGGGTTTCGTTAAAATACCATTCTGCAGATGAGCAAACTAACATGGTAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.20% 0.02% 0.19% NA
All Indica  2759 80.40% 19.30% 0.04% 0.29% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 68.80% 30.90% 0.00% 0.37% NA
Indica I  595 62.50% 36.50% 0.17% 0.84% NA
Indica II  465 78.10% 21.70% 0.00% 0.22% NA
Indica III  913 94.70% 5.30% 0.00% 0.00% NA
Indica Intermediate  786 78.60% 21.10% 0.00% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0105205537 T -> DEL N N silent_mutation Average:36.099; most accessible tissue: Callus, score: 83.262 N N N N
vg0105205537 T -> C LOC_Os01g09990.1 downstream_gene_variant ; 1491.0bp to feature; MODIFIER silent_mutation Average:36.099; most accessible tissue: Callus, score: 83.262 N N N N
vg0105205537 T -> C LOC_Os01g10000.1 downstream_gene_variant ; 4931.0bp to feature; MODIFIER silent_mutation Average:36.099; most accessible tissue: Callus, score: 83.262 N N N N
vg0105205537 T -> C LOC_Os01g09990.2 downstream_gene_variant ; 1491.0bp to feature; MODIFIER silent_mutation Average:36.099; most accessible tissue: Callus, score: 83.262 N N N N
vg0105205537 T -> C LOC_Os01g09990-LOC_Os01g10000 intergenic_region ; MODIFIER silent_mutation Average:36.099; most accessible tissue: Callus, score: 83.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0105205537 1.27E-07 1.09E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 3.41E-06 4.41E-13 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 4.13E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 5.80E-10 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 3.19E-10 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 5.65E-09 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 1.31E-10 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 4.13E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 6.21E-09 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 1.11E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 2.04E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 5.55E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0105205537 NA 9.56E-07 mr1959_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251