Variant ID: vg0105205537 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 5205537 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTTACCATGTTAGTTTGCTCATCTGCAGAATGGTATTTTAACGAAACCCACTTTTGACAATAGCGTAGTCTCAATTTGCCCGTAGTCCGTCTAGGCTCA[T/C]
GTGAATTATTCATCGAAATTATATATAATTAAAAAATAAAAAAAATTATAAATATTGTTTATACGTCATGTTTGATACAACTCCACATCTTAAATTTGCG
CGCAAATTTAAGATGTGGAGTTGTATCAAACATGACGTATAAACAATATTTATAATTTTTTTTATTTTTTAATTATATATAATTTCGATGAATAATTCAC[A/G]
TGAGCCTAGACGGACTACGGGCAAATTGAGACTACGCTATTGTCAAAAGTGGGTTTCGTTAAAATACCATTCTGCAGATGAGCAAACTAACATGGTAAGA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.60% | 13.20% | 0.02% | 0.19% | NA |
All Indica | 2759 | 80.40% | 19.30% | 0.04% | 0.29% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 68.80% | 30.90% | 0.00% | 0.37% | NA |
Indica I | 595 | 62.50% | 36.50% | 0.17% | 0.84% | NA |
Indica II | 465 | 78.10% | 21.70% | 0.00% | 0.22% | NA |
Indica III | 913 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 78.60% | 21.10% | 0.00% | 0.25% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0105205537 | T -> DEL | N | N | silent_mutation | Average:36.099; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
vg0105205537 | T -> C | LOC_Os01g09990.1 | downstream_gene_variant ; 1491.0bp to feature; MODIFIER | silent_mutation | Average:36.099; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
vg0105205537 | T -> C | LOC_Os01g10000.1 | downstream_gene_variant ; 4931.0bp to feature; MODIFIER | silent_mutation | Average:36.099; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
vg0105205537 | T -> C | LOC_Os01g09990.2 | downstream_gene_variant ; 1491.0bp to feature; MODIFIER | silent_mutation | Average:36.099; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
vg0105205537 | T -> C | LOC_Os01g09990-LOC_Os01g10000 | intergenic_region ; MODIFIER | silent_mutation | Average:36.099; most accessible tissue: Callus, score: 83.262 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0105205537 | 1.27E-07 | 1.09E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | 3.41E-06 | 4.41E-13 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 4.13E-06 | mr1795 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 5.80E-10 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 3.19E-10 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 5.65E-09 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 1.31E-10 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 4.13E-09 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 6.21E-09 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 1.11E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 2.04E-07 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 5.55E-08 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0105205537 | NA | 9.56E-07 | mr1959_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |