\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104750274:

Variant ID: vg0104750274 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4750274
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCAGCTCTCTGTAAAGGCTGCTGCTAGCGTTAAATACACCAAAACTGCCTAACAACAAATTCCAACTACTCCTACATCCCCAAATGATTTATTTCTTC[T/A]
TTTTTTTTCTTCTACTTTTTATTTGAGGAAATATCGCATGGTTAACTTGTTACTCCCTCCGTCCCATAATATAAGTGATTTTGATTTTTTTCTTGCAACA

Reverse complement sequence

TGTTGCAAGAAAAAAATCAAAATCACTTATATTATGGGACGGAGGGAGTAACAAGTTAACCATGCGATATTTCCTCAAATAAAAAGTAGAAGAAAAAAAA[A/T]
GAAGAAATAAATCATTTGGGGATGTAGGAGTAGTTGGAATTTGTTGTTAGGCAGTTTTGGTGTATTTAACGCTAGCAGCAGCCTTTACAGAGAGCTGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 9.80% 0.28% 17.33% NA
All Indica  2759 98.50% 0.60% 0.07% 0.80% NA
All Japonica  1512 20.70% 28.60% 0.53% 50.13% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 97.20% 2.40% 0.00% 0.43% NA
Indica III  913 98.70% 0.30% 0.11% 0.88% NA
Indica Intermediate  786 98.10% 0.40% 0.13% 1.40% NA
Temperate Japonica  767 27.10% 49.30% 0.39% 23.21% NA
Tropical Japonica  504 8.30% 4.60% 0.60% 86.51% NA
Japonica Intermediate  241 26.10% 13.30% 0.83% 59.75% NA
VI/Aromatic  96 79.20% 2.10% 0.00% 18.75% NA
Intermediate  90 63.30% 13.30% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104750274 T -> A LOC_Os01g09330.1 downstream_gene_variant ; 1364.0bp to feature; MODIFIER silent_mutation Average:94.779; most accessible tissue: Minghui63 flower, score: 98.277 N N N N
vg0104750274 T -> A LOC_Os01g09340.1 downstream_gene_variant ; 3332.0bp to feature; MODIFIER silent_mutation Average:94.779; most accessible tissue: Minghui63 flower, score: 98.277 N N N N
vg0104750274 T -> A LOC_Os01g09330-LOC_Os01g09340 intergenic_region ; MODIFIER silent_mutation Average:94.779; most accessible tissue: Minghui63 flower, score: 98.277 N N N N
vg0104750274 T -> DEL N N silent_mutation Average:94.779; most accessible tissue: Minghui63 flower, score: 98.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0104750274 T A -0.01 0.02 0.0 0.02 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104750274 1.12E-07 NA mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104750274 8.32E-09 NA mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104750274 1.96E-06 NA mr1057_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104750274 NA 2.54E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104750274 NA 3.06E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251