\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104612596:

Variant ID: vg0104612596 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4612596
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTGCATCTGGTTACAATACTCCACTAATGTATACTTGCGTGGCGATCGAAAAAAGTGTTCACACAAATCACAGTAACTAGGTGATATCCCACACTTTG[C/T]
TGCGGGATACATGGATGAATATATATGTTAAATATTGTTGAAATGACGAAAGAAAATGTTGAGAAAAATGTGAGATGATTTGACATATACTTTTTAAGCT

Reverse complement sequence

AGCTTAAAAAGTATATGTCAAATCATCTCACATTTTTCTCAACATTTTCTTTCGTCATTTCAACAATATTTAACATATATATTCATCCATGTATCCCGCA[G/A]
CAAAGTGTGGGATATCACCTAGTTACTGTGATTTGTGTGAACACTTTTTTCGATCGCCACGCAAGTATACATTAGTGGAGTATTGTAACCAGATGCACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.20% 4.30% 0.61% 15.85% NA
All Indica  2759 83.20% 0.10% 0.18% 16.53% NA
All Japonica  1512 85.90% 12.10% 1.39% 0.60% NA
Aus  269 13.00% 0.00% 1.12% 85.87% NA
Indica I  595 69.90% 0.00% 0.50% 29.58% NA
Indica II  465 97.00% 0.20% 0.00% 2.80% NA
Indica III  913 82.00% 0.00% 0.11% 17.85% NA
Indica Intermediate  786 86.40% 0.30% 0.13% 13.23% NA
Temperate Japonica  767 76.10% 21.10% 2.22% 0.52% NA
Tropical Japonica  504 98.80% 0.00% 0.20% 0.99% NA
Japonica Intermediate  241 90.00% 8.70% 1.24% 0.00% NA
VI/Aromatic  96 41.70% 17.70% 0.00% 40.62% NA
Intermediate  90 83.30% 1.10% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104612596 C -> T LOC_Os01g09170.1 upstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0104612596 C -> T LOC_Os01g09180.1 upstream_gene_variant ; 548.0bp to feature; MODIFIER silent_mutation Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0104612596 C -> T LOC_Os01g09190.1 upstream_gene_variant ; 2286.0bp to feature; MODIFIER silent_mutation Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0104612596 C -> T LOC_Os01g09180-LOC_Os01g09190 intergenic_region ; MODIFIER silent_mutation Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg0104612596 C -> DEL N N silent_mutation Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104612596 NA 6.36E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 8.36E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 9.23E-08 mr1544 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 6.13E-06 NA mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 1.05E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 1.05E-06 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 7.26E-06 mr1544_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 3.69E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 1.19E-12 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 6.41E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104612596 NA 2.38E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251