\
| Variant ID: vg0104612596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4612596 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGTGCATCTGGTTACAATACTCCACTAATGTATACTTGCGTGGCGATCGAAAAAAGTGTTCACACAAATCACAGTAACTAGGTGATATCCCACACTTTG[C/T]
TGCGGGATACATGGATGAATATATATGTTAAATATTGTTGAAATGACGAAAGAAAATGTTGAGAAAAATGTGAGATGATTTGACATATACTTTTTAAGCT
AGCTTAAAAAGTATATGTCAAATCATCTCACATTTTTCTCAACATTTTCTTTCGTCATTTCAACAATATTTAACATATATATTCATCCATGTATCCCGCA[G/A]
CAAAGTGTGGGATATCACCTAGTTACTGTGATTTGTGTGAACACTTTTTTCGATCGCCACGCAAGTATACATTAGTGGAGTATTGTAACCAGATGCACGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.20% | 4.30% | 0.61% | 15.85% | NA |
| All Indica | 2759 | 83.20% | 0.10% | 0.18% | 16.53% | NA |
| All Japonica | 1512 | 85.90% | 12.10% | 1.39% | 0.60% | NA |
| Aus | 269 | 13.00% | 0.00% | 1.12% | 85.87% | NA |
| Indica I | 595 | 69.90% | 0.00% | 0.50% | 29.58% | NA |
| Indica II | 465 | 97.00% | 0.20% | 0.00% | 2.80% | NA |
| Indica III | 913 | 82.00% | 0.00% | 0.11% | 17.85% | NA |
| Indica Intermediate | 786 | 86.40% | 0.30% | 0.13% | 13.23% | NA |
| Temperate Japonica | 767 | 76.10% | 21.10% | 2.22% | 0.52% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 90.00% | 8.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 17.70% | 0.00% | 40.62% | NA |
| Intermediate | 90 | 83.30% | 1.10% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104612596 | C -> T | LOC_Os01g09170.1 | upstream_gene_variant ; 2594.0bp to feature; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0104612596 | C -> T | LOC_Os01g09180.1 | upstream_gene_variant ; 548.0bp to feature; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0104612596 | C -> T | LOC_Os01g09190.1 | upstream_gene_variant ; 2286.0bp to feature; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0104612596 | C -> T | LOC_Os01g09180-LOC_Os01g09190 | intergenic_region ; MODIFIER | silent_mutation | Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| vg0104612596 | C -> DEL | N | N | silent_mutation | Average:41.312; most accessible tissue: Minghui63 root, score: 67.149 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104612596 | NA | 6.36E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 8.36E-08 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 9.23E-08 | mr1544 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | 6.13E-06 | NA | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 1.05E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 1.05E-06 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 7.26E-06 | mr1544_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 3.69E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 1.19E-12 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 6.41E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104612596 | NA | 2.38E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |