| Variant ID: vg0104468017 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4468017 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, G: 0.14, others allele: 0.00, population size: 80. )
GAGCCGAATGCAGCCAAAAGAATACGATTTATGTCACAAAATGTCGAGAAGAAAAGAGAAAAAAAAGAATACCTGCCAAATCACATCAGCAGCTCTTGCA[C/G]
TTATTACGAAAAACAATCAAGAACCTTTGAAACTGCGATCTAACCCATGCAAATCTTCTCCCCTGTGAAAAACTAGTATTAAACGATCAATAATGAAGAG
CTCTTCATTATTGATCGTTTAATACTAGTTTTTCACAGGGGAGAAGATTTGCATGGGTTAGATCGCAGTTTCAAAGGTTCTTGATTGTTTTTCGTAATAA[G/C]
TGCAAGAGCTGCTGATGTGATTTGGCAGGTATTCTTTTTTTTCTCTTTTCTTCTCGACATTTTGTGACATAAATCGTATTCTTTTGGCTGCATTCGGCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.90% | 16.50% | 4.38% | 61.17% | NA |
| All Indica | 2759 | 1.80% | 1.00% | 5.18% | 91.99% | NA |
| All Japonica | 1512 | 50.60% | 46.40% | 0.26% | 2.78% | NA |
| Aus | 269 | 0.00% | 1.50% | 2.23% | 96.28% | NA |
| Indica I | 595 | 0.80% | 0.30% | 1.01% | 97.82% | NA |
| Indica II | 465 | 3.00% | 0.40% | 3.66% | 92.90% | NA |
| Indica III | 913 | 2.00% | 1.30% | 8.21% | 88.50% | NA |
| Indica Intermediate | 786 | 1.70% | 1.50% | 5.73% | 91.09% | NA |
| Temperate Japonica | 767 | 87.20% | 10.20% | 0.39% | 2.22% | NA |
| Tropical Japonica | 504 | 1.60% | 94.40% | 0.20% | 3.77% | NA |
| Japonica Intermediate | 241 | 36.50% | 61.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 21.90% | 22.90% | 45.83% | 9.38% | NA |
| Intermediate | 90 | 13.30% | 27.80% | 11.11% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104468017 | C -> G | LOC_Os01g08890.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:7.634; most accessible tissue: Callus, score: 39.303 | N | N | N | N |
| vg0104468017 | C -> G | LOC_Os01g08890.1 | 5_prime_UTR_variant ; 7799.0bp to feature; MODIFIER | silent_mutation | Average:7.634; most accessible tissue: Callus, score: 39.303 | N | N | N | N |
| vg0104468017 | C -> DEL | N | N | silent_mutation | Average:7.634; most accessible tissue: Callus, score: 39.303 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104468017 | NA | 1.06E-06 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 4.12E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 7.00E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 2.40E-07 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | 5.63E-06 | NA | mr1543 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 5.86E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 2.10E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 4.01E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104468017 | NA | 1.59E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |