Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0104429723:

Variant ID: vg0104429723 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4429723
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTCATGTCAAAATTGGAAGTTTGATTGAAATCGGAACGATGTGATGGAAAAGTTGAAAGTTTGTGTGTGTAGGAAAGTTTTGATGTGATAGAAAAGTTG[G/A,T]
AAGTTTGAAGAAAAAGTTAGGAACTAAACCAGGCCCTTGTACAAAAGAACAAGTGCGAAGCATCTTCCCGACTGCTACTTCCCATTCGGGTGTGTGATAA

Reverse complement sequence

TTATCACACACCCGAATGGGAAGTAGCAGTCGGGAAGATGCTTCGCACTTGTTCTTTTGTACAAGGGCCTGGTTTAGTTCCTAACTTTTTCTTCAAACTT[C/T,A]
CAACTTTTCTATCACATCAAAACTTTCCTACACACACAAACTTTCAACTTTTCCATCACATCGTTCCGATTTCAATCAAACTTCCAATTTTGACATGAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.50%	18.30%	0.19%	0.00%	T: 0.02%
All Indica	2759	98.10%	1.70%	0.14%	0.00%	NA
All Japonica	1512	59.00%	40.70%	0.26%	0.00%	T: 0.07%
Aus	269	43.50%	56.50%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	97.80%	2.00%	0.22%	0.00%	NA
Indica Intermediate	786	96.70%	3.20%	0.13%	0.00%	NA
Temperate Japonica	767	93.20%	6.80%	0.00%	0.00%	NA
Tropical Japonica	504	8.90%	90.70%	0.40%	0.00%	NA
Japonica Intermediate	241	54.80%	44.00%	0.83%	0.00%	T: 0.41%
VI/Aromatic	96	69.80%	30.20%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104429723	G -> T	LOC_Os01g08814.1	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08830.1	upstream_gene_variant ; 4366.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08814.2	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08814.3	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08830.2	upstream_gene_variant ; 4366.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08820.1	downstream_gene_variant ; 1809.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> T	LOC_Os01g08814-LOC_Os01g08820	intergenic_region ; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08814.1	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08830.1	upstream_gene_variant ; 4366.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08814.2	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08814.3	upstream_gene_variant ; 2839.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08830.2	upstream_gene_variant ; 4366.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08820.1	downstream_gene_variant ; 1809.0bp to feature; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0104429723	G -> A	LOC_Os01g08814-LOC_Os01g08820	intergenic_region ; MODIFIER	silent_mutation	Average:34.904; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104429723	NA	8.36E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.39E-20	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	2.13E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	2.36E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	4.23E-13	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.50E-09	mr1657	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	7.30E-13	mr1696	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	3.36E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	2.94E-06	2.94E-06	mr1891	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	4.21E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.64E-13	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	3.43E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.17E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	6.90E-08	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	3.77E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.83E-08	mr1471_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.54E-07	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	4.15E-14	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	5.03E-10	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	3.31E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	5.21E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	1.76E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104429723	NA	5.23E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251