Variant ID: vg0104297093 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 4297093 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 191. )
ATTCCCTGTTATACTACCTTGGAGTTGTATGCTTGTGTCATGCTCAAACAGCTCGACTATTCAGCCCATCCAATTTTCAAATGATCATAACGACTTATTG[T/A]
CGCAGGGTAGAGACATACAAAGAACAAAAAATAATTTTGTTTTTAAAATAGCTCAAAAGAATATTTAGTGAAATTTTATCGGGGTGAATATGTTGGGATC
GATCCCAACATATTCACCCCGATAAAATTTCACTAAATATTCTTTTGAGCTATTTTAAAAACAAAATTATTTTTTGTTCTTTGTATGTCTCTACCCTGCG[A/T]
CAATAAGTCGTTATGATCATTTGAAAATTGGATGGGCTGAATAGTCGAGCTGTTTGAGCATGACACAAGCATACAACTCCAAGGTAGTATAACAGGGAAT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 57.90% | 42.10% | 0.06% | 0.00% | NA |
All Indica | 2759 | 90.00% | 9.90% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 12.10% | 87.90% | 0.00% | 0.00% | NA |
Aus | 269 | 8.20% | 91.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 86.70% | 13.00% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 88.70% | 11.20% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0104297093 | T -> A | LOC_Os01g08630.1 | downstream_gene_variant ; 774.0bp to feature; MODIFIER | silent_mutation | Average:34.121; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
vg0104297093 | T -> A | LOC_Os01g08620-LOC_Os01g08630 | intergenic_region ; MODIFIER | silent_mutation | Average:34.121; most accessible tissue: Zhenshan97 flower, score: 49.964 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0104297093 | 9.72E-06 | 9.72E-06 | mr1498 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0104297093 | NA | 2.74E-08 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0104297093 | 9.64E-07 | 4.51E-08 | mr1925 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0104297093 | 3.66E-07 | 1.56E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0104297093 | NA | 9.20E-08 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0104297093 | 1.09E-07 | 1.09E-07 | mr1925_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |