\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104261328:

Variant ID: vg0104261328 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4261328
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGGTCTGAATTTTTGCACATCCATGTAGTAGTGAGCATCCTCTAAACTCTCCTTGTGTATCGACATTAATTGCACTGTAAAGTGGAAGACTATATATC[T/A]
CCTACACTTGTCAACAACTCGACATAGGGGGTATATGGAGTTGTTGGATTATCCTCGAACCGGTAGTCTATCTGGGGCCCATACTTTGGTTTGGATTACT

Reverse complement sequence

AGTAATCCAAACCAAAGTATGGGCCCCAGATAGACTACCGGTTCGAGGATAATCCAACAACTCCATATACCCCCTATGTCGAGTTGTTGACAAGTGTAGG[A/T]
GATATATAGTCTTCCACTTTACAGTGCAATTAATGTCGATACACAAGGAGAGTTTAGAGGATGCTCACTACTACATGGATGTGCAAAAATTCAGACCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.10% 0.99% 0.00% NA
All Indica  2759 39.30% 59.30% 1.45% 0.00% NA
All Japonica  1512 97.40% 2.20% 0.33% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 31.10% 66.70% 2.18% 0.00% NA
Indica II  465 8.60% 90.30% 1.08% 0.00% NA
Indica III  913 59.80% 40.00% 0.22% 0.00% NA
Indica Intermediate  786 39.70% 57.80% 2.54% 0.00% NA
Temperate Japonica  767 97.30% 2.30% 0.39% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 2.50% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104261328 T -> A LOC_Os01g08570.1 upstream_gene_variant ; 2919.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0104261328 T -> A LOC_Os01g08560.1 downstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0104261328 T -> A LOC_Os01g08560.2 downstream_gene_variant ; 1702.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0104261328 T -> A LOC_Os01g08560-LOC_Os01g08570 intergenic_region ; MODIFIER silent_mutation Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104261328 NA 1.74E-12 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 4.62E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 1.42E-17 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 6.31E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 8.67E-18 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 3.80E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 6.45E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 9.67E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 3.39E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 7.22E-10 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 6.54E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 2.13E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 3.36E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 1.61E-23 mr1180_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 5.15E-09 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 2.23E-27 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 8.36E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 2.76E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 1.04E-08 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 3.25E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 9.13E-16 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 7.18E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328 NA 2.93E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251