Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104261328:

Variant ID: vg0104261328 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4261328
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.01, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGGTCTGAATTTTTGCACATCCATGTAGTAGTGAGCATCCTCTAAACTCTCCTTGTGTATCGACATTAATTGCACTGTAAAGTGGAAGACTATATATC[T/A]
CCTACACTTGTCAACAACTCGACATAGGGGGTATATGGAGTTGTTGGATTATCCTCGAACCGGTAGTCTATCTGGGGCCCATACTTTGGTTTGGATTACT

Reverse complement sequence

AGTAATCCAAACCAAAGTATGGGCCCCAGATAGACTACCGGTTCGAGGATAATCCAACAACTCCATATACCCCCTATGTCGAGTTGTTGACAAGTGTAGG[A/T]
GATATATAGTCTTCCACTTTACAGTGCAATTAATGTCGATACACAAGGAGAGTTTAGAGGATGCTCACTACTACATGGATGTGCAAAAATTCAGACCCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	36.10%	0.99%	0.00%	NA
All Indica	2759	39.30%	59.30%	1.45%	0.00%	NA
All Japonica	1512	97.40%	2.20%	0.33%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	31.10%	66.70%	2.18%	0.00%	NA
Indica II	465	8.60%	90.30%	1.08%	0.00%	NA
Indica III	913	59.80%	40.00%	0.22%	0.00%	NA
Indica Intermediate	786	39.70%	57.80%	2.54%	0.00%	NA
Temperate Japonica	767	97.30%	2.30%	0.39%	0.00%	NA
Tropical Japonica	504	97.80%	2.00%	0.20%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104261328	T -> A	LOC_Os01g08570.1	upstream_gene_variant ; 2919.0bp to feature; MODIFIER	silent_mutation	Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0104261328	T -> A	LOC_Os01g08560.1	downstream_gene_variant ; 1702.0bp to feature; MODIFIER	silent_mutation	Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0104261328	T -> A	LOC_Os01g08560.2	downstream_gene_variant ; 1702.0bp to feature; MODIFIER	silent_mutation	Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0104261328	T -> A	LOC_Os01g08560-LOC_Os01g08570	intergenic_region ; MODIFIER	silent_mutation	Average:66.563; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104261328	NA	1.74E-12	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	4.62E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	1.42E-17	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	6.31E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	8.67E-18	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	3.80E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	6.45E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	9.67E-06	mr1911	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	3.39E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	7.22E-10	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	6.54E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	2.13E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	3.36E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	1.61E-23	mr1180_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	5.15E-09	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	2.23E-27	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	8.36E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	2.76E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	1.04E-08	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	3.25E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	9.13E-16	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	7.18E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104261328	NA	2.93E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251