\
| Variant ID: vg0104031438 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 4031438 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTCAGATTTTAAAATTGATGCATACATGCAAAAGTACTTCTTTAATAACGAAAACAAGTCATAAAAAATAATATCTTTATATTTTTTTTCAATAAAAT[G/A]
AGTGATCAAACAATATATTAAAGTCAATAACATCATCTATTGAAAACGAAGATAGTACATATAGTATACTATAAGTATATACGACACACACTAGCTGCAT
ATGCAGCTAGTGTGTGTCGTATATACTTATAGTATACTATATGTACTATCTTCGTTTTCAATAGATGATGTTATTGACTTTAATATATTGTTTGATCACT[C/T]
ATTTTATTGAAAAAAAATATAAAGATATTATTTTTTATGACTTGTTTTCGTTATTAAAGAAGTACTTTTGCATGTATGCATCAATTTTAAAATCTGACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 1.40% | 1.21% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 2.30% | 1.85% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.00% | 3.70% | 0.00% | NA |
| Indica II | 465 | 86.20% | 9.00% | 4.73% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.30% | 2.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0104031438 | G -> A | LOC_Os01g08250.1 | upstream_gene_variant ; 849.0bp to feature; MODIFIER | silent_mutation | Average:54.439; most accessible tissue: Callus, score: 94.417 | N | N | N | N |
| vg0104031438 | G -> A | LOC_Os01g08260.1 | downstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:54.439; most accessible tissue: Callus, score: 94.417 | N | N | N | N |
| vg0104031438 | G -> A | LOC_Os01g08260.2 | downstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:54.439; most accessible tissue: Callus, score: 94.417 | N | N | N | N |
| vg0104031438 | G -> A | LOC_Os01g08250-LOC_Os01g08260 | intergenic_region ; MODIFIER | silent_mutation | Average:54.439; most accessible tissue: Callus, score: 94.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0104031438 | NA | 9.50E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | 3.35E-07 | 2.50E-17 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | NA | 1.35E-14 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | NA | 5.88E-09 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | 1.23E-06 | 2.12E-13 | mr1951 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | NA | 4.01E-08 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | NA | 4.58E-14 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | 2.39E-07 | 2.07E-20 | mr1769_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | NA | 6.27E-09 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0104031438 | 3.52E-06 | 8.37E-13 | mr1951_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |