Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0104031438:

Variant ID: vg0104031438 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 4031438
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTCAGATTTTAAAATTGATGCATACATGCAAAAGTACTTCTTTAATAACGAAAACAAGTCATAAAAAATAATATCTTTATATTTTTTTTCAATAAAAT[G/A]
AGTGATCAAACAATATATTAAAGTCAATAACATCATCTATTGAAAACGAAGATAGTACATATAGTATACTATAAGTATATACGACACACACTAGCTGCAT

Reverse complement sequence

ATGCAGCTAGTGTGTGTCGTATATACTTATAGTATACTATATGTACTATCTTCGTTTTCAATAGATGATGTTATTGACTTTAATATATTGTTTGATCACT[C/T]
ATTTTATTGAAAAAAAATATAAAGATATTATTTTTTATGACTTGTTTTCGTTATTAAAGAAGTACTTTTGCATGTATGCATCAATTTTAAAATCTGACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	1.40%	1.21%	0.00%	NA
All Indica	2759	95.80%	2.30%	1.85%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	0.00%	3.70%	0.00%	NA
Indica II	465	86.20%	9.00%	4.73%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.30%	2.80%	0.89%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0104031438	G -> A	LOC_Os01g08250.1	upstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:54.439; most accessible tissue: Callus, score: 94.417	N	N	N	N
vg0104031438	G -> A	LOC_Os01g08260.1	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:54.439; most accessible tissue: Callus, score: 94.417	N	N	N	N
vg0104031438	G -> A	LOC_Os01g08260.2	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:54.439; most accessible tissue: Callus, score: 94.417	N	N	N	N
vg0104031438	G -> A	LOC_Os01g08250-LOC_Os01g08260	intergenic_region ; MODIFIER	silent_mutation	Average:54.439; most accessible tissue: Callus, score: 94.417	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0104031438	NA	9.50E-06	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	3.35E-07	2.50E-17	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	NA	1.35E-14	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	NA	5.88E-09	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	1.23E-06	2.12E-13	mr1951	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	NA	4.01E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	NA	4.58E-14	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	2.39E-07	2.07E-20	mr1769_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	NA	6.27E-09	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438	3.52E-06	8.37E-13	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251