\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0104031438:

Variant ID: vg0104031438 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 4031438
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTCAGATTTTAAAATTGATGCATACATGCAAAAGTACTTCTTTAATAACGAAAACAAGTCATAAAAAATAATATCTTTATATTTTTTTTCAATAAAAT[G/A]
AGTGATCAAACAATATATTAAAGTCAATAACATCATCTATTGAAAACGAAGATAGTACATATAGTATACTATAAGTATATACGACACACACTAGCTGCAT

Reverse complement sequence

ATGCAGCTAGTGTGTGTCGTATATACTTATAGTATACTATATGTACTATCTTCGTTTTCAATAGATGATGTTATTGACTTTAATATATTGTTTGATCACT[C/T]
ATTTTATTGAAAAAAAATATAAAGATATTATTTTTTATGACTTGTTTTCGTTATTAAAGAAGTACTTTTGCATGTATGCATCAATTTTAAAATCTGACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.40% 1.21% 0.00% NA
All Indica  2759 95.80% 2.30% 1.85% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 0.00% 3.70% 0.00% NA
Indica II  465 86.20% 9.00% 4.73% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 2.80% 0.89% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0104031438 G -> A LOC_Os01g08250.1 upstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:54.439; most accessible tissue: Callus, score: 94.417 N N N N
vg0104031438 G -> A LOC_Os01g08260.1 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:54.439; most accessible tissue: Callus, score: 94.417 N N N N
vg0104031438 G -> A LOC_Os01g08260.2 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:54.439; most accessible tissue: Callus, score: 94.417 N N N N
vg0104031438 G -> A LOC_Os01g08250-LOC_Os01g08260 intergenic_region ; MODIFIER silent_mutation Average:54.439; most accessible tissue: Callus, score: 94.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0104031438 NA 9.50E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 3.35E-07 2.50E-17 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 NA 1.35E-14 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 NA 5.88E-09 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 1.23E-06 2.12E-13 mr1951 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 NA 4.01E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 NA 4.58E-14 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 2.39E-07 2.07E-20 mr1769_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 NA 6.27E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0104031438 3.52E-06 8.37E-13 mr1951_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251