\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103997397:

Variant ID: vg0103997397 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 3997397
Reference Allele: TAlternative Allele: A,TA,TAA,TTA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, T: 0.18, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAGGTGTGTTTTGGTCCTTTTTGAGACAGCTTCCTTTATGAGGTCCATCTGAAGGCTGCCAACTGTAGTCAGCCATTGTTTTTTTTTCTTTTTTTTTT[T/A,TA,TAA,TTA]
AAAAAAACTTGTAGTCAGTCGTGATTCGAATTTAAGACCTCTAGGCTTGATATGCATCTGGCTGACACAAAATAATTGCAGTTTTCACGTCAGCTGTAGT

Reverse complement sequence

ACTACAGCTGACGTGAAAACTGCAATTATTTTGTGTCAGCCAGATGCATATCAAGCCTAGAGGTCTTAAATTCGAATCACGACTGACTACAAGTTTTTTT[A/T,TA,TTA,TAA]
AAAAAAAAAAGAAAAAAAAACAATGGCTGACTACAGTTGGCAGCCTTCAGATGGACCTCATAAAGGAAGCTGTCTCAAAAAGGACCAAAACACACCTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 36.70% 0.61% 0.00% TA: 0.59%; TTA: 0.02%; TAA: 0.02%
All Indica  2759 96.50% 2.90% 0.29% 0.00% TA: 0.29%; TAA: 0.04%
All Japonica  1512 3.70% 94.80% 0.93% 0.00% TA: 0.53%
Aus  269 48.70% 45.00% 1.86% 0.00% TA: 4.09%; TTA: 0.37%
Indica I  595 98.30% 0.80% 0.67% 0.00% TA: 0.17%
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 96.40% 3.00% 0.11% 0.00% TA: 0.44%; TAA: 0.11%
Indica Intermediate  786 95.00% 4.30% 0.25% 0.00% TA: 0.38%
Temperate Japonica  767 3.80% 93.60% 1.56% 0.00% TA: 1.04%
Tropical Japonica  504 4.00% 95.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 33.30% 65.60% 0.00% 0.00% TA: 1.04%
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103997397 T -> TA LOC_Os01g08200.1 downstream_gene_variant ; 2000.0bp to feature; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> TA LOC_Os01g08200-LOC_Os01g08220 intergenic_region ; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> A LOC_Os01g08200.1 downstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> A LOC_Os01g08200-LOC_Os01g08220 intergenic_region ; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> TTA LOC_Os01g08200.1 downstream_gene_variant ; 2000.0bp to feature; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> TTA LOC_Os01g08200-LOC_Os01g08220 intergenic_region ; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> TAA LOC_Os01g08200.1 downstream_gene_variant ; 2000.0bp to feature; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0103997397 T -> TAA LOC_Os01g08200-LOC_Os01g08220 intergenic_region ; MODIFIER silent_mutation Average:79.321; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103997397 T A -0.01 0.0 0.0 0.0 0.0 0.0
vg0103997397 T TA 0.09 -0.05 -0.04 -0.03 -0.02 -0.06
vg0103997397 T TAA 0.18 -0.23 -0.16 -0.04 -0.02 0.26
vg0103997397 T TTA 0.18 -0.23 -0.16 -0.04 -0.02 0.25

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103997397 4.99E-06 5.09E-12 mr1457 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103997397 NA 9.95E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103997397 NA 5.61E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251