\
| Variant ID: vg0103964702 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3964702 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 200. )
GTATATTCACAGTTAAATTTATTGTTTTTGTTACAACTTGTAGAAGTCGAATTTGGACTTGCATGTTTGTGAAGTGATATATTACATATTAACCTATCAT[A/G]
TCAATTTTTTTGAAATTTTTTCATAACCATTTAGATGACATGCAAGAAACGGGTGGACATCCACCCGAGTGTTTAAAACAGTTTCCCCTAGTGTCATTGA
TCAATGACACTAGGGGAAACTGTTTTAAACACTCGGGTGGATGTCCACCCGTTTCTTGCATGTCATCTAAATGGTTATGAAAAAATTTCAAAAAAATTGA[T/C]
ATGATAGGTTAATATGTAATATATCACTTCACAAACATGCAAGTCCAAATTCGACTTCTACAAGTTGTAACAAAAACAATAAATTTAACTGTGAATATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 37.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 71.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103964702 | A -> G | LOC_Os01g08180.1 | upstream_gene_variant ; 1134.0bp to feature; MODIFIER | silent_mutation | Average:33.291; most accessible tissue: Callus, score: 64.81 | N | N | N | N |
| vg0103964702 | A -> G | LOC_Os01g08170.1 | downstream_gene_variant ; 2577.0bp to feature; MODIFIER | silent_mutation | Average:33.291; most accessible tissue: Callus, score: 64.81 | N | N | N | N |
| vg0103964702 | A -> G | LOC_Os01g08180-LOC_Os01g08190 | intergenic_region ; MODIFIER | silent_mutation | Average:33.291; most accessible tissue: Callus, score: 64.81 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103964702 | NA | 1.08E-08 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.08E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 5.43E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.89E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | 3.74E-06 | 2.20E-12 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | 7.56E-06 | 7.24E-19 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.08E-15 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 9.56E-14 | mr1325 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.28E-16 | mr1326 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 7.80E-14 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.42E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.64E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 6.89E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.86E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.86E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 5.79E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 9.74E-47 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.16E-22 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.52E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 1.40E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 4.64E-08 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 8.26E-18 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.06E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.91E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103964702 | NA | 2.41E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |