\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103964702:

Variant ID: vg0103964702 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3964702
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GTATATTCACAGTTAAATTTATTGTTTTTGTTACAACTTGTAGAAGTCGAATTTGGACTTGCATGTTTGTGAAGTGATATATTACATATTAACCTATCAT[A/G]
TCAATTTTTTTGAAATTTTTTCATAACCATTTAGATGACATGCAAGAAACGGGTGGACATCCACCCGAGTGTTTAAAACAGTTTCCCCTAGTGTCATTGA

Reverse complement sequence

TCAATGACACTAGGGGAAACTGTTTTAAACACTCGGGTGGATGTCCACCCGTTTCTTGCATGTCATCTAAATGGTTATGAAAAAATTTCAAAAAAATTGA[T/C]
ATGATAGGTTAATATGTAATATATCACTTCACAAACATGCAAGTCCAAATTCGACTTCTACAAGTTGTAACAAAAACAATAAATTTAACTGTGAATATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.10% 0.06% 0.00% NA
All Indica  2759 98.10% 1.80% 0.04% 0.00% NA
All Japonica  1512 3.40% 96.60% 0.00% 0.00% NA
Aus  269 50.90% 49.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 71.90% 1.04% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103964702 A -> G LOC_Os01g08180.1 upstream_gene_variant ; 1134.0bp to feature; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 64.81 N N N N
vg0103964702 A -> G LOC_Os01g08170.1 downstream_gene_variant ; 2577.0bp to feature; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 64.81 N N N N
vg0103964702 A -> G LOC_Os01g08180-LOC_Os01g08190 intergenic_region ; MODIFIER silent_mutation Average:33.291; most accessible tissue: Callus, score: 64.81 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103964702 NA 1.08E-08 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.08E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 5.43E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.89E-12 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 3.74E-06 2.20E-12 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 7.56E-06 7.24E-19 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.08E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 9.56E-14 mr1325 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.28E-16 mr1326 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 7.80E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.42E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.64E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 6.89E-24 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.86E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.86E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 5.79E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 9.74E-47 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.16E-22 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.52E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 1.40E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 4.64E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 8.26E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.06E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.91E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103964702 NA 2.41E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251