\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103508890:

Variant ID: vg0103508890 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3508890
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTATTTAAATATCTCCAATAACAAACAACTAGCAAATACTACCTCCGTCCCAAAATAAGTGCAGCCATAGATATCCGTGTCCAACGTTTTAACCGTC[T/C]
GTCTTATTTGAAAATTTTATGAAAAAAAATTAAAAATATTAGTCACACATAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATCAT

Reverse complement sequence

ATGATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTATGTGTGACTAATATTTTTAATTTTTTTTCATAAAATTTTCAAATAAGAC[A/G]
GACGGTTAAAACGTTGGACACGGATATCTATGGCTGCACTTATTTTGGGACGGAGGTAGTATTTGCTAGTTGTTTGTTATTGGAGATATTTAAATACATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 30.20% 0.63% 1.67% NA
All Indica  2759 93.90% 2.40% 1.09% 2.65% NA
All Japonica  1512 15.00% 84.90% 0.00% 0.13% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 97.50% 1.80% 0.50% 0.17% NA
Indica II  465 85.20% 3.00% 1.29% 10.54% NA
Indica III  913 95.80% 2.20% 1.31% 0.66% NA
Indica Intermediate  786 94.10% 2.50% 1.15% 2.16% NA
Temperate Japonica  767 25.70% 74.10% 0.00% 0.26% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 37.50% 0.00% 1.04% NA
Intermediate  90 60.00% 36.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103508890 T -> DEL N N silent_mutation Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0103508890 T -> C LOC_Os01g07410.1 upstream_gene_variant ; 2945.0bp to feature; MODIFIER silent_mutation Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0103508890 T -> C LOC_Os01g07390.1 downstream_gene_variant ; 4057.0bp to feature; MODIFIER silent_mutation Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0103508890 T -> C LOC_Os01g07400.1 intron_variant ; MODIFIER silent_mutation Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0103508890 T -> C LOC_Os01g07400.2 intron_variant ; MODIFIER silent_mutation Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103508890 NA 1.82E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 1.56E-07 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 NA 2.82E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 1.21E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 NA 1.29E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 NA 1.52E-24 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103508890 NA 1.15E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251