\
| Variant ID: vg0103508890 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3508890 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATGTATTTAAATATCTCCAATAACAAACAACTAGCAAATACTACCTCCGTCCCAAAATAAGTGCAGCCATAGATATCCGTGTCCAACGTTTTAACCGTC[T/C]
GTCTTATTTGAAAATTTTATGAAAAAAAATTAAAAATATTAGTCACACATAAAGTACTATTCATGTATTATCATCTAATAACAATAAAAATACTAATCAT
ATGATTAGTATTTTTATTGTTATTAGATGATAATACATGAATAGTACTTTATGTGTGACTAATATTTTTAATTTTTTTTCATAAAATTTTCAAATAAGAC[A/G]
GACGGTTAAAACGTTGGACACGGATATCTATGGCTGCACTTATTTTGGGACGGAGGTAGTATTTGCTAGTTGTTTGTTATTGGAGATATTTAAATACATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 30.20% | 0.63% | 1.67% | NA |
| All Indica | 2759 | 93.90% | 2.40% | 1.09% | 2.65% | NA |
| All Japonica | 1512 | 15.00% | 84.90% | 0.00% | 0.13% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.80% | 0.50% | 0.17% | NA |
| Indica II | 465 | 85.20% | 3.00% | 1.29% | 10.54% | NA |
| Indica III | 913 | 95.80% | 2.20% | 1.31% | 0.66% | NA |
| Indica Intermediate | 786 | 94.10% | 2.50% | 1.15% | 2.16% | NA |
| Temperate Japonica | 767 | 25.70% | 74.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 37.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103508890 | T -> DEL | N | N | silent_mutation | Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0103508890 | T -> C | LOC_Os01g07410.1 | upstream_gene_variant ; 2945.0bp to feature; MODIFIER | silent_mutation | Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0103508890 | T -> C | LOC_Os01g07390.1 | downstream_gene_variant ; 4057.0bp to feature; MODIFIER | silent_mutation | Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0103508890 | T -> C | LOC_Os01g07400.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0103508890 | T -> C | LOC_Os01g07400.2 | intron_variant ; MODIFIER | silent_mutation | Average:48.427; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103508890 | NA | 1.82E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | 1.56E-07 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | NA | 2.82E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | 1.21E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | NA | 1.29E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | NA | 1.52E-24 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103508890 | NA | 1.15E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |