Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103442104:

Variant ID: vg0103442104 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3442104
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

GCGGCAGATCTGGTCCCCCACGTCGTTGCAGCGACAGATCCGGCCTAACCCGTTATCGTAGTGGCGGATCCAGCCACCCTCGTCGTCGCGGTGGCGGATC[C/T]
GGCCTCCCCCATCGTCGCGGCGGCCGGATCTAGCCCCGAGCTCACGGCGGCCAGCGGCGAAGAGGAGTAGGCCGCACCCTGCCGCCGCTACCGAGGCCCT

Reverse complement sequence

AGGGCCTCGGTAGCGGCGGCAGGGTGCGGCCTACTCCTCTTCGCCGCTGGCCGCCGTGAGCTCGGGGCTAGATCCGGCCGCCGCGACGATGGGGGAGGCC[G/A]
GATCCGCCACCGCGACGACGAGGGTGGCTGGATCCGCCACTACGATAACGGGTTAGGCCGGATCTGTCGCTGCAACGACGTGGGGGACCAGATCTGCCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	37.70%	0.61%	3.28%	NA
All Indica	2759	51.90%	46.80%	0.47%	0.83%	NA
All Japonica	1512	61.90%	29.70%	0.86%	7.54%	NA
Aus	269	92.60%	1.90%	0.74%	4.83%	NA
Indica I	595	84.90%	15.10%	0.00%	0.00%	NA
Indica II	465	28.20%	71.00%	0.86%	0.00%	NA
Indica III	913	44.00%	54.40%	0.22%	1.31%	NA
Indica Intermediate	786	50.30%	47.50%	0.89%	1.40%	NA
Temperate Japonica	767	77.70%	8.00%	1.56%	12.78%	NA
Tropical Japonica	504	37.30%	61.70%	0.00%	0.99%	NA
Japonica Intermediate	241	63.10%	32.00%	0.41%	4.56%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	56.70%	41.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103442104	C -> T	LOC_Os01g07300.1	upstream_gene_variant ; 3055.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07300.2	upstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07310.1	downstream_gene_variant ; 4832.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07310.3	downstream_gene_variant ; 4832.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07310.4	downstream_gene_variant ; 4832.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07310.2	downstream_gene_variant ; 4833.0bp to feature; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> T	LOC_Os01g07280-LOC_Os01g07300	intergenic_region ; MODIFIER	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N
vg0103442104	C -> DEL	N	N	silent_mutation	Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0103442104	C	T	-0.01	-0.01	-0.01	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103442104	NA	1.31E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	9.82E-06	mr1060	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	4.10E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	1.02E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	4.82E-06	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	4.52E-06	mr1318	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	2.28E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	6.86E-07	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	7.59E-08	mr1693	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	5.23E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	4.69E-14	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	1.23E-08	mr1887	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	3.08E-07	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	5.54E-06	mr1937	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	1.30E-09	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	9.70E-06	mr1691_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	2.69E-09	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104	NA	1.16E-06	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251