\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103442104:

Variant ID: vg0103442104 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3442104
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


GCGGCAGATCTGGTCCCCCACGTCGTTGCAGCGACAGATCCGGCCTAACCCGTTATCGTAGTGGCGGATCCAGCCACCCTCGTCGTCGCGGTGGCGGATC[C/T]
GGCCTCCCCCATCGTCGCGGCGGCCGGATCTAGCCCCGAGCTCACGGCGGCCAGCGGCGAAGAGGAGTAGGCCGCACCCTGCCGCCGCTACCGAGGCCCT

Reverse complement sequence

AGGGCCTCGGTAGCGGCGGCAGGGTGCGGCCTACTCCTCTTCGCCGCTGGCCGCCGTGAGCTCGGGGCTAGATCCGGCCGCCGCGACGATGGGGGAGGCC[G/A]
GATCCGCCACCGCGACGACGAGGGTGGCTGGATCCGCCACTACGATAACGGGTTAGGCCGGATCTGTCGCTGCAACGACGTGGGGGACCAGATCTGCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 37.70% 0.61% 3.28% NA
All Indica  2759 51.90% 46.80% 0.47% 0.83% NA
All Japonica  1512 61.90% 29.70% 0.86% 7.54% NA
Aus  269 92.60% 1.90% 0.74% 4.83% NA
Indica I  595 84.90% 15.10% 0.00% 0.00% NA
Indica II  465 28.20% 71.00% 0.86% 0.00% NA
Indica III  913 44.00% 54.40% 0.22% 1.31% NA
Indica Intermediate  786 50.30% 47.50% 0.89% 1.40% NA
Temperate Japonica  767 77.70% 8.00% 1.56% 12.78% NA
Tropical Japonica  504 37.30% 61.70% 0.00% 0.99% NA
Japonica Intermediate  241 63.10% 32.00% 0.41% 4.56% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 56.70% 41.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103442104 C -> T LOC_Os01g07300.1 upstream_gene_variant ; 3055.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07300.2 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07310.1 downstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07310.3 downstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07310.4 downstream_gene_variant ; 4832.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07310.2 downstream_gene_variant ; 4833.0bp to feature; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> T LOC_Os01g07280-LOC_Os01g07300 intergenic_region ; MODIFIER silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N
vg0103442104 C -> DEL N N silent_mutation Average:77.772; most accessible tissue: Zhenshan97 flag leaf, score: 91.094 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103442104 C T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103442104 NA 1.31E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 9.82E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 4.10E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 1.02E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 4.82E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 4.52E-06 mr1318 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 2.28E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 6.86E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 7.59E-08 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 5.23E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 4.69E-14 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 1.23E-08 mr1887 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 3.08E-07 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 5.54E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 1.30E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 9.70E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 2.69E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103442104 NA 1.16E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251