\
| Variant ID: vg0103417456 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3417456 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAACATATGGCACAAGAGTTAGTAGTACCCACTAGTACATTAGTACAAAAGCGAACTGGTACTAAAACTTTTTAAACTACTCATTTCAAAACCAGCAGC[G/A]
ACAAGAACAAATGGAAAGACAAGCATATCAACACAAAGTACTCTATCCGTCCCATAAAAAACCAACATAGTACTTACTCTGTTTCACAATGTAAGTCATT
AATGACTTACATTGTGAAACAGAGTAAGTACTATGTTGGTTTTTTATGGGACGGATAGAGTACTTTGTGTTGATATGCTTGTCTTTCCATTTGTTCTTGT[C/T]
GCTGCTGGTTTTGAAATGAGTAGTTTAAAAAGTTTTAGTACCAGTTCGCTTTTGTACTAATGTACTAGTGGGTACTACTAACTCTTGTGCCATATGTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 49.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 24.30% | 75.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 5.70% | 94.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 26.20% | 73.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 36.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103417456 | G -> A | LOC_Os01g07240.1 | upstream_gene_variant ; 1470.0bp to feature; MODIFIER | silent_mutation | Average:36.126; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0103417456 | G -> A | LOC_Os01g07250.1 | upstream_gene_variant ; 4555.0bp to feature; MODIFIER | silent_mutation | Average:36.126; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0103417456 | G -> A | LOC_Os01g07240-LOC_Os01g07250 | intergenic_region ; MODIFIER | silent_mutation | Average:36.126; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103417456 | NA | 3.04E-12 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 4.97E-19 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.32E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 2.04E-11 | mr1249 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | 5.66E-06 | 5.66E-06 | mr1249 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.76E-09 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 7.12E-17 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | 1.37E-06 | NA | mr1327 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 8.25E-06 | mr1327 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.76E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.26E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.49E-12 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 8.98E-07 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 5.67E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.08E-19 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 4.48E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.66E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 6.55E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 2.88E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.86E-16 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 2.91E-07 | mr1881 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.54E-15 | mr1151_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | 3.08E-06 | 3.08E-06 | mr1151_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 5.04E-07 | mr1161_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.02E-22 | mr1164_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.08E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 4.43E-13 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 3.93E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 6.24E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 2.53E-08 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 9.50E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 5.10E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | 9.97E-06 | 2.72E-07 | mr1713_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.16E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 7.06E-06 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 4.50E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103417456 | NA | 1.60E-25 | mr1943_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |