\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103416812:

Variant ID: vg0103416812 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3416812
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATCAACAACATTACTCTTTTAAACATAGATAATTTATTTAATTAGATTTATTAGTTTGAGGGGTTTTTTATTCCGATAAATTTTCGTTACCGTATT[C/T]
GCGCCGGTTCGTTTTCGCTCCGCTTTCGATTTCGATAATATTCGATTCCGTTTTCGTATCCGGGGTTTCCGATTCCGATTTCGATTCCGAAAAAAAATAT

Reverse complement sequence

ATATTTTTTTTCGGAATCGAAATCGGAATCGGAAACCCCGGATACGAAAACGGAATCGAATATTATCGAAATCGAAAGCGGAGCGAAAACGAACCGGCGC[G/A]
AATACGGTAACGAAAATTTATCGGAATAAAAAACCCCTCAAACTAATAAATCTAATTAAATAAATTATCTATGTTTAAAAGAGTAATGTTGTTGATAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 3.70% 8.70% 33.62% NA
All Indica  2759 33.60% 6.10% 13.95% 46.36% NA
All Japonica  1512 83.20% 0.00% 0.26% 16.53% NA
Aus  269 84.80% 3.00% 5.95% 6.32% NA
Indica I  595 11.40% 9.20% 14.79% 64.54% NA
Indica II  465 28.80% 3.70% 12.90% 54.62% NA
Indica III  913 48.30% 4.40% 15.44% 31.87% NA
Indica Intermediate  786 36.30% 7.00% 12.21% 44.53% NA
Temperate Japonica  767 73.10% 0.00% 0.13% 26.73% NA
Tropical Japonica  504 96.40% 0.00% 0.40% 3.17% NA
Japonica Intermediate  241 87.60% 0.00% 0.41% 12.03% NA
VI/Aromatic  96 79.20% 0.00% 5.21% 15.62% NA
Intermediate  90 65.60% 2.20% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103416812 C -> T LOC_Os01g07240.1 upstream_gene_variant ; 826.0bp to feature; MODIFIER silent_mutation Average:16.214; most accessible tissue: Callus, score: 29.434 N N N N
vg0103416812 C -> T LOC_Os01g07240-LOC_Os01g07250 intergenic_region ; MODIFIER silent_mutation Average:16.214; most accessible tissue: Callus, score: 29.434 N N N N
vg0103416812 C -> DEL N N silent_mutation Average:16.214; most accessible tissue: Callus, score: 29.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103416812 NA 1.75E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 6.03E-17 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 2.65E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 5.98E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.15E-10 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 2.31E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 4.97E-07 NA mr1327 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 4.01E-06 2.41E-15 mr1352 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.30E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 6.50E-07 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.08E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.04E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.03E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 1.86E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 6.33E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 2.77E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 2.56E-09 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 2.89E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 3.05E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 5.05E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812 NA 8.30E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251