Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103416812:

Variant ID: vg0103416812 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3416812
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATCAACAACATTACTCTTTTAAACATAGATAATTTATTTAATTAGATTTATTAGTTTGAGGGGTTTTTTATTCCGATAAATTTTCGTTACCGTATT[C/T]
GCGCCGGTTCGTTTTCGCTCCGCTTTCGATTTCGATAATATTCGATTCCGTTTTCGTATCCGGGGTTTCCGATTCCGATTTCGATTCCGAAAAAAAATAT

Reverse complement sequence

ATATTTTTTTTCGGAATCGAAATCGGAATCGGAAACCCCGGATACGAAAACGGAATCGAATATTATCGAAATCGAAAGCGGAGCGAAAACGAACCGGCGC[G/A]
AATACGGTAACGAAAATTTATCGGAATAAAAAACCCCTCAAACTAATAAATCTAATTAAATAAATTATCTATGTTTAAAAGAGTAATGTTGTTGATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	3.70%	8.70%	33.62%	NA
All Indica	2759	33.60%	6.10%	13.95%	46.36%	NA
All Japonica	1512	83.20%	0.00%	0.26%	16.53%	NA
Aus	269	84.80%	3.00%	5.95%	6.32%	NA
Indica I	595	11.40%	9.20%	14.79%	64.54%	NA
Indica II	465	28.80%	3.70%	12.90%	54.62%	NA
Indica III	913	48.30%	4.40%	15.44%	31.87%	NA
Indica Intermediate	786	36.30%	7.00%	12.21%	44.53%	NA
Temperate Japonica	767	73.10%	0.00%	0.13%	26.73%	NA
Tropical Japonica	504	96.40%	0.00%	0.40%	3.17%	NA
Japonica Intermediate	241	87.60%	0.00%	0.41%	12.03%	NA
VI/Aromatic	96	79.20%	0.00%	5.21%	15.62%	NA
Intermediate	90	65.60%	2.20%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103416812	C -> T	LOC_Os01g07240.1	upstream_gene_variant ; 826.0bp to feature; MODIFIER	silent_mutation	Average:16.214; most accessible tissue: Callus, score: 29.434	N	N	N	N
vg0103416812	C -> T	LOC_Os01g07240-LOC_Os01g07250	intergenic_region ; MODIFIER	silent_mutation	Average:16.214; most accessible tissue: Callus, score: 29.434	N	N	N	N
vg0103416812	C -> DEL	N	N	silent_mutation	Average:16.214; most accessible tissue: Callus, score: 29.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103416812	NA	1.75E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	6.03E-17	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	2.65E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	5.98E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.15E-10	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	2.31E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	4.97E-07	NA	mr1327	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	4.01E-06	2.41E-15	mr1352	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.30E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	6.50E-07	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.08E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.04E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.03E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	1.86E-13	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	6.33E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	2.77E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	2.56E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	2.89E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	3.05E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	5.05E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103416812	NA	8.30E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251