Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103304407:

Variant ID: vg0103304407 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3304407
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GAAATGATAACATGTAACGATTGATCTGTAAGGCACTTTTAAGAGAAGAAATGACATGCTCATGATCTGCTTGGTGATTAGTTTTGAATTTGTAGACTAT[A/G]
ATTCTATAAAGAATATTCAGGATGAAGATATATATGCAGATTTGTCAGAACGTGCTGCTCGTGTCTGTCCCTAACGACACTGCAATACCATGTTGGGCAG

Reverse complement sequence

CTGCCCAACATGGTATTGCAGTGTCGTTAGGGACAGACACGAGCAGCACGTTCTGACAAATCTGCATATATATCTTCATCCTGAATATTCTTTATAGAAT[T/C]
ATAGTCTACAAATTCAAAACTAATCACCAAGCAGATCATGAGCATGTCATTTCTTCTCTTAAAAGTGCCTTACAGATCAATCGTTACATGTTATCATTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	48.80%	0.85%	0.13%	NA
All Indica	2759	75.70%	24.00%	0.33%	0.00%	NA
All Japonica	1512	15.50%	82.20%	1.85%	0.40%	NA
Aus	269	5.60%	94.10%	0.37%	0.00%	NA
Indica I	595	95.30%	4.50%	0.17%	0.00%	NA
Indica II	465	91.40%	8.20%	0.43%	0.00%	NA
Indica III	913	53.70%	46.10%	0.22%	0.00%	NA
Indica Intermediate	786	77.20%	22.30%	0.51%	0.00%	NA
Temperate Japonica	767	17.10%	81.70%	0.91%	0.26%	NA
Tropical Japonica	504	15.50%	83.50%	0.79%	0.20%	NA
Japonica Intermediate	241	10.80%	80.90%	7.05%	1.24%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	37.80%	60.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103304407	A -> G	LOC_Os01g07000.1	upstream_gene_variant ; 3397.0bp to feature; MODIFIER	silent_mutation	Average:39.549; most accessible tissue: Minghui63 root, score: 58.187	N	N	N	N
vg0103304407	A -> G	LOC_Os01g07010.1	upstream_gene_variant ; 315.0bp to feature; MODIFIER	silent_mutation	Average:39.549; most accessible tissue: Minghui63 root, score: 58.187	N	N	N	N
vg0103304407	A -> G	LOC_Os01g07020.1	downstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:39.549; most accessible tissue: Minghui63 root, score: 58.187	N	N	N	N
vg0103304407	A -> G	LOC_Os01g07010-LOC_Os01g07020	intergenic_region ; MODIFIER	silent_mutation	Average:39.549; most accessible tissue: Minghui63 root, score: 58.187	N	N	N	N
vg0103304407	A -> DEL	N	N	silent_mutation	Average:39.549; most accessible tissue: Minghui63 root, score: 58.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103304407	NA	3.82E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	4.38E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	2.18E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	2.27E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	3.59E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	3.39E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	3.38E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	6.79E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	4.12E-07	4.12E-07	mr1967	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	1.66E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	1.47E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	7.46E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	8.84E-06	mr1194_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	1.23E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	5.49E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	8.13E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	9.33E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	7.77E-06	7.77E-06	mr1356_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	4.48E-06	4.48E-06	mr1365_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	3.70E-06	2.38E-06	mr1741_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	8.01E-06	mr1837_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407	NA	7.13E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251