\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103304407:

Variant ID: vg0103304407 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3304407
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GAAATGATAACATGTAACGATTGATCTGTAAGGCACTTTTAAGAGAAGAAATGACATGCTCATGATCTGCTTGGTGATTAGTTTTGAATTTGTAGACTAT[A/G]
ATTCTATAAAGAATATTCAGGATGAAGATATATATGCAGATTTGTCAGAACGTGCTGCTCGTGTCTGTCCCTAACGACACTGCAATACCATGTTGGGCAG

Reverse complement sequence

CTGCCCAACATGGTATTGCAGTGTCGTTAGGGACAGACACGAGCAGCACGTTCTGACAAATCTGCATATATATCTTCATCCTGAATATTCTTTATAGAAT[T/C]
ATAGTCTACAAATTCAAAACTAATCACCAAGCAGATCATGAGCATGTCATTTCTTCTCTTAAAAGTGCCTTACAGATCAATCGTTACATGTTATCATTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 48.80% 0.85% 0.13% NA
All Indica  2759 75.70% 24.00% 0.33% 0.00% NA
All Japonica  1512 15.50% 82.20% 1.85% 0.40% NA
Aus  269 5.60% 94.10% 0.37% 0.00% NA
Indica I  595 95.30% 4.50% 0.17% 0.00% NA
Indica II  465 91.40% 8.20% 0.43% 0.00% NA
Indica III  913 53.70% 46.10% 0.22% 0.00% NA
Indica Intermediate  786 77.20% 22.30% 0.51% 0.00% NA
Temperate Japonica  767 17.10% 81.70% 0.91% 0.26% NA
Tropical Japonica  504 15.50% 83.50% 0.79% 0.20% NA
Japonica Intermediate  241 10.80% 80.90% 7.05% 1.24% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103304407 A -> G LOC_Os01g07000.1 upstream_gene_variant ; 3397.0bp to feature; MODIFIER silent_mutation Average:39.549; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0103304407 A -> G LOC_Os01g07010.1 upstream_gene_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:39.549; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0103304407 A -> G LOC_Os01g07020.1 downstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:39.549; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0103304407 A -> G LOC_Os01g07010-LOC_Os01g07020 intergenic_region ; MODIFIER silent_mutation Average:39.549; most accessible tissue: Minghui63 root, score: 58.187 N N N N
vg0103304407 A -> DEL N N silent_mutation Average:39.549; most accessible tissue: Minghui63 root, score: 58.187 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103304407 NA 3.82E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 4.38E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 2.18E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 2.27E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 3.59E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 3.39E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 3.38E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 6.79E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 4.12E-07 4.12E-07 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 1.66E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 1.47E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 7.46E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 8.84E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 1.23E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 5.49E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 8.13E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 9.33E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 7.77E-06 7.77E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 4.48E-06 4.48E-06 mr1365_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 3.70E-06 2.38E-06 mr1741_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 8.01E-06 mr1837_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103304407 NA 7.13E-09 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251