\
| Variant ID: vg0103243222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3243222 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATATTAGAGTATCGTACGAAAGCAAGTATAAAATCGCTCTATCAGGATAATACGGCTGTCACTTACAAAGGGAACACTCTTATGTTCACTAAAATCCT[G/A,T]
ACCACCTTCAAAGCAATTGATCTCTCAGACAACTCATTTGGTGGTCCTATTCCAAAGTCAATGGGGGAAGCTTGCTTCACTACATGGATTTAACCTGTCC
GGACAGGTTAAATCCATGTAGTGAAGCAAGCTTCCCCCATTGACTTTGGAATAGGACCACCAAATGAGTTGTCTGAGAGATCAATTGCTTTGAAGGTGGT[C/T,A]
AGGATTTTAGTGAACATAAGAGTGTTCCCTTTGTAAGTGACAGCCGTATTATCCTGATAGAGCGATTTTATACTTGCTTTCGTACGATACTCTAATATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 0.60% | 0.51% | 10.30% | T: 0.57% |
| All Indica | 2759 | 98.00% | 0.00% | 0.14% | 1.12% | T: 0.69% |
| All Japonica | 1512 | 67.50% | 1.80% | 0.79% | 29.70% | T: 0.26% |
| Aus | 269 | 96.70% | 0.00% | 2.23% | 0.00% | T: 1.12% |
| Indica I | 595 | 98.70% | 0.00% | 0.00% | 1.34% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 97.30% | 0.00% | 0.22% | 0.99% | T: 1.53% |
| Indica Intermediate | 786 | 98.00% | 0.00% | 0.25% | 1.15% | T: 0.64% |
| Temperate Japonica | 767 | 92.80% | 1.70% | 0.52% | 4.95% | NA |
| Tropical Japonica | 504 | 30.80% | 2.40% | 1.19% | 65.08% | T: 0.60% |
| Japonica Intermediate | 241 | 63.50% | 0.80% | 0.83% | 34.44% | T: 0.41% |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 0.00% | T: 1.04% |
| Intermediate | 90 | 90.00% | 1.10% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103243222 | G -> T | LOC_Os01g06836.1 | synonymous_variant ; p.Leu490Leu; LOW | synonymous_codon | Average:54.713; most accessible tissue: Callus, score: 78.93 | N | N | N | N |
| vg0103243222 | G -> A | LOC_Os01g06836.1 | synonymous_variant ; p.Leu490Leu; LOW | synonymous_codon | Average:54.713; most accessible tissue: Callus, score: 78.93 | N | N | N | N |
| vg0103243222 | G -> DEL | LOC_Os01g06836.1 | N | frameshift_variant | Average:54.713; most accessible tissue: Callus, score: 78.93 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103243222 | 3.86E-06 | 3.86E-06 | mr1054 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 2.60E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 3.49E-07 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 2.20E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 1.92E-07 | mr1289 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 1.27E-06 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | 5.87E-06 | 5.87E-06 | mr1372 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 3.84E-08 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 7.65E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | 1.08E-06 | 1.08E-06 | mr1972 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103243222 | NA | 4.31E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |