Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103158009:

Variant ID: vg0103158009 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3158009
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTGCTCCGGTACCTATTGACGATGTACCTTCAGTTGTGCCGGCTGCTAATGCTCCTGTCCGCTCTTCTCCGGTGATGCCGGCGGCTGATGCCGCTTCA[G/A,T]
CTCCGGGACCCTCGACTCAAAAGCATCAGGAAGGTAAGGATGACTAGACTCCTAATAGAGGTCATATTCTCCTTTGCTTTCTCTTGATGTATTTTCTTCT

Reverse complement sequence

AGAAGAAAATACATCAAGAGAAAGCAAAGGAGAATATGACCTCTATTAGGAGTCTAGTCATCCTTACCTTCCTGATGCTTTTGAGTCGAGGGTCCCGGAG[C/T,A]
TGAAGCGGCATCAGCCGCCGGCATCACCGGAGAAGAGCGGACAGGAGCATTAGCAGCCGGCACAACTGAAGGTACATCGTCAATAGGTACCGGAGCAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	2.30%	13.94%	10.37%	T: 0.02%
All Indica	2759	75.40%	1.90%	16.75%	5.91%	NA
All Japonica	1512	65.50%	3.30%	10.71%	20.50%	NA
Aus	269	83.60%	1.10%	11.15%	3.72%	T: 0.37%
Indica I	595	67.10%	1.00%	25.04%	6.89%	NA
Indica II	465	81.90%	0.90%	10.32%	6.88%	NA
Indica III	913	78.80%	2.80%	14.68%	3.72%	NA
Indica Intermediate	786	74.00%	2.20%	16.67%	7.12%	NA
Temperate Japonica	767	72.60%	0.40%	9.39%	17.60%	NA
Tropical Japonica	504	55.00%	3.00%	11.90%	30.16%	NA
Japonica Intermediate	241	64.70%	13.30%	12.45%	9.54%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	88.90%	0.00%	5.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103158009	G -> T	LOC_Os01g06690.1	missense_variant ; p.Ala232Ser; MODERATE	nonsynonymous_codon ; A232S	Average:10.882; most accessible tissue: Callus, score: 35.066	unknown	unknown	TOLERATED	0.18
vg0103158009	G -> A	LOC_Os01g06690.1	missense_variant ; p.Ala232Thr; MODERATE	nonsynonymous_codon ; A232T	Average:10.882; most accessible tissue: Callus, score: 35.066	unknown	unknown	TOLERATED	0.63
vg0103158009	G -> DEL	LOC_Os01g06690.1	N	frameshift_variant	Average:10.882; most accessible tissue: Callus, score: 35.066	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103158009	6.97E-06	6.97E-06	mr1098	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	4.04E-07	1.02E-09	mr1113	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	5.22E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	7.42E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.59E-09	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.38E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	9.07E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	5.93E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	4.02E-07	2.09E-11	mr1123	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	4.19E-07	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	2.52E-07	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	5.11E-09	mr1242	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	7.84E-09	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	6.97E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	8.57E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.70E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	9.38E-06	4.02E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	5.14E-08	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	2.27E-07	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.76E-06	mr1961	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	9.11E-07	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.42E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	5.29E-07	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.68E-07	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.24E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	6.33E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	9.13E-09	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	4.38E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	2.44E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009	NA	1.03E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251