\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103158009:

Variant ID: vg0103158009 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3158009
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTGCTCCGGTACCTATTGACGATGTACCTTCAGTTGTGCCGGCTGCTAATGCTCCTGTCCGCTCTTCTCCGGTGATGCCGGCGGCTGATGCCGCTTCA[G/A,T]
CTCCGGGACCCTCGACTCAAAAGCATCAGGAAGGTAAGGATGACTAGACTCCTAATAGAGGTCATATTCTCCTTTGCTTTCTCTTGATGTATTTTCTTCT

Reverse complement sequence

AGAAGAAAATACATCAAGAGAAAGCAAAGGAGAATATGACCTCTATTAGGAGTCTAGTCATCCTTACCTTCCTGATGCTTTTGAGTCGAGGGTCCCGGAG[C/T,A]
TGAAGCGGCATCAGCCGCCGGCATCACCGGAGAAGAGCGGACAGGAGCATTAGCAGCCGGCACAACTGAAGGTACATCGTCAATAGGTACCGGAGCAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 2.30% 13.94% 10.37% T: 0.02%
All Indica  2759 75.40% 1.90% 16.75% 5.91% NA
All Japonica  1512 65.50% 3.30% 10.71% 20.50% NA
Aus  269 83.60% 1.10% 11.15% 3.72% T: 0.37%
Indica I  595 67.10% 1.00% 25.04% 6.89% NA
Indica II  465 81.90% 0.90% 10.32% 6.88% NA
Indica III  913 78.80% 2.80% 14.68% 3.72% NA
Indica Intermediate  786 74.00% 2.20% 16.67% 7.12% NA
Temperate Japonica  767 72.60% 0.40% 9.39% 17.60% NA
Tropical Japonica  504 55.00% 3.00% 11.90% 30.16% NA
Japonica Intermediate  241 64.70% 13.30% 12.45% 9.54% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 88.90% 0.00% 5.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103158009 G -> T LOC_Os01g06690.1 missense_variant ; p.Ala232Ser; MODERATE nonsynonymous_codon ; A232S Average:10.882; most accessible tissue: Callus, score: 35.066 unknown unknown TOLERATED 0.18
vg0103158009 G -> A LOC_Os01g06690.1 missense_variant ; p.Ala232Thr; MODERATE nonsynonymous_codon ; A232T Average:10.882; most accessible tissue: Callus, score: 35.066 unknown unknown TOLERATED 0.63
vg0103158009 G -> DEL LOC_Os01g06690.1 N frameshift_variant Average:10.882; most accessible tissue: Callus, score: 35.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103158009 6.97E-06 6.97E-06 mr1098 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 4.04E-07 1.02E-09 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 5.22E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 7.42E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.59E-09 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.38E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 9.07E-07 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 5.93E-06 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 4.02E-07 2.09E-11 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 4.19E-07 mr1150 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 2.52E-07 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 5.11E-09 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 7.84E-09 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 6.97E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 8.57E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.70E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 9.38E-06 4.02E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 5.14E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 2.27E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.76E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 9.11E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.42E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 5.29E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.68E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.24E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 6.33E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 9.13E-09 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 4.38E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 2.44E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103158009 NA 1.03E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251