\
| Variant ID: vg0103158009 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3158009 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTTGCTCCGGTACCTATTGACGATGTACCTTCAGTTGTGCCGGCTGCTAATGCTCCTGTCCGCTCTTCTCCGGTGATGCCGGCGGCTGATGCCGCTTCA[G/A,T]
CTCCGGGACCCTCGACTCAAAAGCATCAGGAAGGTAAGGATGACTAGACTCCTAATAGAGGTCATATTCTCCTTTGCTTTCTCTTGATGTATTTTCTTCT
AGAAGAAAATACATCAAGAGAAAGCAAAGGAGAATATGACCTCTATTAGGAGTCTAGTCATCCTTACCTTCCTGATGCTTTTGAGTCGAGGGTCCCGGAG[C/T,A]
TGAAGCGGCATCAGCCGCCGGCATCACCGGAGAAGAGCGGACAGGAGCATTAGCAGCCGGCACAACTGAAGGTACATCGTCAATAGGTACCGGAGCAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 2.30% | 13.94% | 10.37% | T: 0.02% |
| All Indica | 2759 | 75.40% | 1.90% | 16.75% | 5.91% | NA |
| All Japonica | 1512 | 65.50% | 3.30% | 10.71% | 20.50% | NA |
| Aus | 269 | 83.60% | 1.10% | 11.15% | 3.72% | T: 0.37% |
| Indica I | 595 | 67.10% | 1.00% | 25.04% | 6.89% | NA |
| Indica II | 465 | 81.90% | 0.90% | 10.32% | 6.88% | NA |
| Indica III | 913 | 78.80% | 2.80% | 14.68% | 3.72% | NA |
| Indica Intermediate | 786 | 74.00% | 2.20% | 16.67% | 7.12% | NA |
| Temperate Japonica | 767 | 72.60% | 0.40% | 9.39% | 17.60% | NA |
| Tropical Japonica | 504 | 55.00% | 3.00% | 11.90% | 30.16% | NA |
| Japonica Intermediate | 241 | 64.70% | 13.30% | 12.45% | 9.54% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 5.56% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103158009 | G -> T | LOC_Os01g06690.1 | missense_variant ; p.Ala232Ser; MODERATE | nonsynonymous_codon ; A232S | Average:10.882; most accessible tissue: Callus, score: 35.066 | unknown | unknown | TOLERATED | 0.18 |
| vg0103158009 | G -> A | LOC_Os01g06690.1 | missense_variant ; p.Ala232Thr; MODERATE | nonsynonymous_codon ; A232T | Average:10.882; most accessible tissue: Callus, score: 35.066 | unknown | unknown | TOLERATED | 0.63 |
| vg0103158009 | G -> DEL | LOC_Os01g06690.1 | N | frameshift_variant | Average:10.882; most accessible tissue: Callus, score: 35.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103158009 | 6.97E-06 | 6.97E-06 | mr1098 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | 4.04E-07 | 1.02E-09 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 5.22E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 7.42E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.59E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.38E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 9.07E-07 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 5.93E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | 4.02E-07 | 2.09E-11 | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 4.19E-07 | mr1150 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 2.52E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 5.11E-09 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 7.84E-09 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 6.97E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 8.57E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.70E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | 9.38E-06 | 4.02E-07 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 5.14E-08 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 2.27E-07 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.76E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 9.11E-07 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.42E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 5.29E-07 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.68E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.24E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 6.33E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 9.13E-09 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 4.38E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 2.44E-07 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103158009 | NA | 1.03E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |