\
| Variant ID: vg0103132043 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3132043 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )
CTCTATAGAGTGGCTCAGGAAACGGTAGTACACCTCCTTGCAAATTGTAAATACTCCAGAAGGATGCAACACTAGGCTAGCATAGACCTTTGTCACACCC[C/T]
GATCCGGCACCGCCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGAAAAACGGCGTGAACCGCTTCCTACGAAACCGCGATCTTAGTACCAGTCCCAG
CTGGGACTGGTACTAAGATCGCGGTTTCGTAGGAAGCGGTTCACGCCGTTTTTCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGGCGGTGCCGGATC[G/A]
GGGTGTGACAAAGGTCTATGCTAGCCTAGTGTTGCATCCTTCTGGAGTATTTACAATTTGCAAGGAGGTGTACTACCGTTTCCTGAGCCACTCTATAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 12.50% | 0.00% | 0.70% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 60.60% | 37.50% | 0.00% | 1.92% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 37.70% | 61.30% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 95.80% | 3.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 59.80% | 33.60% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103132043 | C -> T | LOC_Os01g06650.1 | upstream_gene_variant ; 2174.0bp to feature; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> T | LOC_Os01g06640.1 | downstream_gene_variant ; 1321.0bp to feature; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> T | LOC_Os01g06660.1 | downstream_gene_variant ; 4061.0bp to feature; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> T | LOC_Os01g06640.3 | downstream_gene_variant ; 1321.0bp to feature; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> T | LOC_Os01g06640.2 | downstream_gene_variant ; 1321.0bp to feature; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> T | LOC_Os01g06640-LOC_Os01g06650 | intergenic_region ; MODIFIER | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| vg0103132043 | C -> DEL | N | N | silent_mutation | Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103132043 | NA | 9.65E-06 | mr1303 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | NA | 2.77E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | NA | 1.32E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | 6.84E-06 | 4.31E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | 4.14E-08 | NA | mr1806_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | NA | 3.29E-14 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | NA | 2.43E-11 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103132043 | NA | 5.08E-17 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |