Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103132043:

Variant ID: vg0103132043 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3132043
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTATAGAGTGGCTCAGGAAACGGTAGTACACCTCCTTGCAAATTGTAAATACTCCAGAAGGATGCAACACTAGGCTAGCATAGACCTTTGTCACACCC[C/T]
GATCCGGCACCGCCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGAAAAACGGCGTGAACCGCTTCCTACGAAACCGCGATCTTAGTACCAGTCCCAG

Reverse complement sequence

CTGGGACTGGTACTAAGATCGCGGTTTCGTAGGAAGCGGTTCACGCCGTTTTTCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGGCGGTGCCGGATC[G/A]
GGGTGTGACAAAGGTCTATGCTAGCCTAGTGTTGCATCCTTCTGGAGTATTTACAATTTGCAAGGAGGTGTACTACCGTTTCCTGAGCCACTCTATAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	12.50%	0.00%	0.70%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.04%	NA
All Japonica	1512	60.60%	37.50%	0.00%	1.92%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	37.70%	61.30%	0.00%	1.04%	NA
Tropical Japonica	504	95.80%	3.20%	0.00%	0.99%	NA
Japonica Intermediate	241	59.80%	33.60%	0.00%	6.64%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	93.30%	4.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103132043	C -> T	LOC_Os01g06650.1	upstream_gene_variant ; 2174.0bp to feature; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> T	LOC_Os01g06640.1	downstream_gene_variant ; 1321.0bp to feature; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> T	LOC_Os01g06660.1	downstream_gene_variant ; 4061.0bp to feature; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> T	LOC_Os01g06640.3	downstream_gene_variant ; 1321.0bp to feature; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> T	LOC_Os01g06640.2	downstream_gene_variant ; 1321.0bp to feature; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> T	LOC_Os01g06640-LOC_Os01g06650	intergenic_region ; MODIFIER	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N
vg0103132043	C -> DEL	N	N	silent_mutation	Average:58.852; most accessible tissue: Minghui63 root, score: 75.155	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103132043	NA	9.65E-06	mr1303	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	NA	2.77E-06	mr1791	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	NA	1.32E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	6.84E-06	4.31E-09	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	4.14E-08	NA	mr1806_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	NA	3.29E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	NA	2.43E-11	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043	NA	5.08E-17	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251