\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103132043:

Variant ID: vg0103132043 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3132043
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTATAGAGTGGCTCAGGAAACGGTAGTACACCTCCTTGCAAATTGTAAATACTCCAGAAGGATGCAACACTAGGCTAGCATAGACCTTTGTCACACCC[C/T]
GATCCGGCACCGCCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGAAAAACGGCGTGAACCGCTTCCTACGAAACCGCGATCTTAGTACCAGTCCCAG

Reverse complement sequence

CTGGGACTGGTACTAAGATCGCGGTTTCGTAGGAAGCGGTTCACGCCGTTTTTCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGGCGGTGCCGGATC[G/A]
GGGTGTGACAAAGGTCTATGCTAGCCTAGTGTTGCATCCTTCTGGAGTATTTACAATTTGCAAGGAGGTGTACTACCGTTTCCTGAGCCACTCTATAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.50% 0.00% 0.70% NA
All Indica  2759 99.80% 0.20% 0.00% 0.04% NA
All Japonica  1512 60.60% 37.50% 0.00% 1.92% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.11% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 37.70% 61.30% 0.00% 1.04% NA
Tropical Japonica  504 95.80% 3.20% 0.00% 0.99% NA
Japonica Intermediate  241 59.80% 33.60% 0.00% 6.64% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103132043 C -> T LOC_Os01g06650.1 upstream_gene_variant ; 2174.0bp to feature; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> T LOC_Os01g06640.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> T LOC_Os01g06660.1 downstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> T LOC_Os01g06640.3 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> T LOC_Os01g06640.2 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> T LOC_Os01g06640-LOC_Os01g06650 intergenic_region ; MODIFIER silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0103132043 C -> DEL N N silent_mutation Average:58.852; most accessible tissue: Minghui63 root, score: 75.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103132043 NA 9.65E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 NA 2.77E-06 mr1791 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 NA 1.32E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 6.84E-06 4.31E-09 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 4.14E-08 NA mr1806_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 NA 3.29E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 NA 2.43E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103132043 NA 5.08E-17 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251