\
| Variant ID: vg0102388565 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2388565 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAATTTCTAATTTGAACCTACCTGTGTGTTCTTTTTGTGCTAATCACGGCATGGTTATGTCCAGAATAAATAAGACAAGAATGTGAGGGCTAGTTGCTC[G/T,A]
TTCAAAGAAATATATATACTTCTTTCCAGAGTAATTGTAGTTCTGCAGTTGGAGGATTTTTGTTTTCTTTCAATATTTCTGTACTGCCTACATTGTGGAA
TTCCACAATGTAGGCAGTACAGAAATATTGAAAGAAAACAAAAATCCTCCAACTGCAGAACTACAATTACTCTGGAAAGAAGTATATATATTTCTTTGAA[C/A,T]
GAGCAACTAGCCCTCACATTCTTGTCTTATTTATTCTGGACATAACCATGCCGTGATTAGCACAAAAAGAACACACAGGTAGGTTCAAATTAGAAATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 8.40% | 0.11% | 0.00% | A: 0.63% |
| All Indica | 2759 | 98.40% | 0.50% | 0.00% | 0.00% | A: 1.01% |
| All Japonica | 1512 | 75.70% | 24.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.00% | A: 0.74% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 0.10% | 0.00% | 0.00% | A: 2.74% |
| Indica Intermediate | 786 | 98.30% | 1.30% | 0.00% | 0.00% | A: 0.38% |
| Temperate Japonica | 767 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 40.90% | 58.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 18.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102388565 | G -> T | LOC_Os01g05090.1 | 3_prime_UTR_variant ; 276.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> T | LOC_Os01g05100.1 | 3_prime_UTR_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> T | LOC_Os01g05080.1 | upstream_gene_variant ; 2927.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> T | LOC_Os01g05105.1 | upstream_gene_variant ; 4915.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> T | LOC_Os01g05080.2 | upstream_gene_variant ; 2927.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> A | LOC_Os01g05090.1 | 3_prime_UTR_variant ; 276.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> A | LOC_Os01g05100.1 | 3_prime_UTR_variant ; 377.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> A | LOC_Os01g05080.1 | upstream_gene_variant ; 2927.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> A | LOC_Os01g05105.1 | upstream_gene_variant ; 4915.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0102388565 | G -> A | LOC_Os01g05080.2 | upstream_gene_variant ; 2927.0bp to feature; MODIFIER | silent_mutation | Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102388565 | NA | 3.55E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | NA | 2.21E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | 5.10E-07 | 1.40E-14 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | 1.72E-06 | 1.49E-19 | mr1769 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | NA | 6.07E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | NA | 1.12E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | NA | 7.01E-09 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | NA | 9.47E-08 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | 1.02E-08 | 2.42E-18 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102388565 | 8.76E-08 | 5.19E-21 | mr1769_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |