\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102388565:

Variant ID: vg0102388565 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2388565
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTTCTAATTTGAACCTACCTGTGTGTTCTTTTTGTGCTAATCACGGCATGGTTATGTCCAGAATAAATAAGACAAGAATGTGAGGGCTAGTTGCTC[G/T,A]
TTCAAAGAAATATATATACTTCTTTCCAGAGTAATTGTAGTTCTGCAGTTGGAGGATTTTTGTTTTCTTTCAATATTTCTGTACTGCCTACATTGTGGAA

Reverse complement sequence

TTCCACAATGTAGGCAGTACAGAAATATTGAAAGAAAACAAAAATCCTCCAACTGCAGAACTACAATTACTCTGGAAAGAAGTATATATATTTCTTTGAA[C/A,T]
GAGCAACTAGCCCTCACATTCTTGTCTTATTTATTCTGGACATAACCATGCCGTGATTAGCACAAAAAGAACACACAGGTAGGTTCAAATTAGAAATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 8.40% 0.11% 0.00% A: 0.63%
All Indica  2759 98.40% 0.50% 0.00% 0.00% A: 1.01%
All Japonica  1512 75.70% 24.10% 0.20% 0.00% NA
Aus  269 99.30% 0.00% 0.00% 0.00% A: 0.74%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 97.20% 0.10% 0.00% 0.00% A: 2.74%
Indica Intermediate  786 98.30% 1.30% 0.00% 0.00% A: 0.38%
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 40.90% 58.90% 0.20% 0.00% NA
Japonica Intermediate  241 80.90% 18.30% 0.83% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102388565 G -> T LOC_Os01g05090.1 3_prime_UTR_variant ; 276.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> T LOC_Os01g05100.1 3_prime_UTR_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> T LOC_Os01g05080.1 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> T LOC_Os01g05105.1 upstream_gene_variant ; 4915.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> T LOC_Os01g05080.2 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> A LOC_Os01g05090.1 3_prime_UTR_variant ; 276.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> A LOC_Os01g05100.1 3_prime_UTR_variant ; 377.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> A LOC_Os01g05080.1 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> A LOC_Os01g05105.1 upstream_gene_variant ; 4915.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N
vg0102388565 G -> A LOC_Os01g05080.2 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:36.275; most accessible tissue: Zhenshan97 root, score: 55.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102388565 NA 3.55E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 NA 2.21E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 5.10E-07 1.40E-14 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 1.72E-06 1.49E-19 mr1769 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 NA 6.07E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 NA 1.12E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 NA 7.01E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 NA 9.47E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 1.02E-08 2.42E-18 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102388565 8.76E-08 5.19E-21 mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251