| Variant ID: vg0102329091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2329091 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 250. )
ACCACTTGTCAGCCTCTTAGTACGTAGTAGGCGGAGGCCTGGGGTACCCTTGTAACTTTTCATACGATCCATGGGACTATACAATTGTAATTCATTTCCC[A/G]
AAGGGAGCAGGAGCAAAAGTAATCCAGAAAACACACGATCCACTATTGATTCATGTTGGATTATTCTATTTCAACATTGACATCATCTATGGGGATCGGA
TCCGATCCCCATAGATGATGTCAATGTTGAAATAGAATAATCCAACATGAATCAATAGTGGATCGTGTGTTTTCTGGATTACTTTTGCTCCTGCTCCCTT[T/C]
GGGAAATGAATTACAATTGTATAGTCCCATGGATCGTATGAAAAGTTACAAGGGTACCCCAGGCCTCCGCCTACTACGTACTAAGAGGCTGACAAGTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 0.70% | 8.44% | 5.59% | NA |
| All Indica | 2759 | 78.00% | 1.20% | 12.54% | 8.34% | NA |
| All Japonica | 1512 | 95.70% | 0.00% | 2.65% | 1.65% | NA |
| Aus | 269 | 97.80% | 0.00% | 1.12% | 1.12% | NA |
| Indica I | 595 | 86.10% | 0.00% | 11.60% | 2.35% | NA |
| Indica II | 465 | 64.10% | 3.00% | 22.15% | 10.75% | NA |
| Indica III | 913 | 80.90% | 0.70% | 7.23% | 11.17% | NA |
| Indica Intermediate | 786 | 76.60% | 1.50% | 13.74% | 8.14% | NA |
| Temperate Japonica | 767 | 94.40% | 0.00% | 4.69% | 0.91% | NA |
| Tropical Japonica | 504 | 97.40% | 0.00% | 0.60% | 1.98% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 0.41% | 3.32% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 7.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102329091 | A -> G | LOC_Os01g04970.1 | downstream_gene_variant ; 235.0bp to feature; MODIFIER | silent_mutation | Average:52.8; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0102329091 | A -> G | LOC_Os01g04970-LOC_Os01g04980 | intergenic_region ; MODIFIER | silent_mutation | Average:52.8; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0102329091 | A -> DEL | N | N | silent_mutation | Average:52.8; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102329091 | 9.17E-06 | NA | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102329091 | 1.38E-06 | 1.02E-06 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102329091 | 9.62E-06 | NA | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102329091 | 1.22E-07 | 7.69E-08 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102329091 | 4.56E-06 | 4.56E-06 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |