\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102258475:

Variant ID: vg0102258475 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2258475
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACCATTCTTTTTCACCTACTTTCTCTTTTCAACCAATCACACACCTTCTTCAATCATTCTCACCTACTTTCTTAATACCCGTGCCAACCTCAAAAATG[C/T]
TTACATTTTGGGACGGATGAAGTACACTGATATGGACCTCCTTCGCTGCCTCACGCATGTGAAGTCCCTCGCTTCCTCACGTCTGTGAAGTCAGCCTTTT

Reverse complement sequence

AAAAGGCTGACTTCACAGACGTGAGGAAGCGAGGGACTTCACATGCGTGAGGCAGCGAAGGAGGTCCATATCAGTGTACTTCATCCGTCCCAAAATGTAA[G/A]
CATTTTTGAGGTTGGCACGGGTATTAAGAAAGTAGGTGAGAATGATTGAAGAAGGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTGAAAAAGAATGGTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 29.50% 0.51% 0.00% NA
All Indica  2759 88.10% 11.90% 0.04% 0.00% NA
All Japonica  1512 52.50% 46.00% 1.52% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 80.20% 19.70% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.60% 0.00% 0.00% NA
Temperate Japonica  767 22.00% 75.10% 2.87% 0.00% NA
Tropical Japonica  504 93.70% 6.20% 0.20% 0.00% NA
Japonica Intermediate  241 63.50% 36.50% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102258475 C -> T LOC_Os01g04870.1 upstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:95.964; most accessible tissue: Zhenshan97 flag leaf, score: 98.818 N N N N
vg0102258475 C -> T LOC_Os01g04880.1 upstream_gene_variant ; 2980.0bp to feature; MODIFIER silent_mutation Average:95.964; most accessible tissue: Zhenshan97 flag leaf, score: 98.818 N N N N
vg0102258475 C -> T LOC_Os01g04880.2 upstream_gene_variant ; 2980.0bp to feature; MODIFIER silent_mutation Average:95.964; most accessible tissue: Zhenshan97 flag leaf, score: 98.818 N N N N
vg0102258475 C -> T LOC_Os01g04870-LOC_Os01g04880 intergenic_region ; MODIFIER silent_mutation Average:95.964; most accessible tissue: Zhenshan97 flag leaf, score: 98.818 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102258475 C T -0.02 0.0 0.0 0.0 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102258475 6.04E-06 2.71E-10 mr1415 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102258475 6.04E-06 2.71E-10 mr1567 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102258475 9.33E-06 NA mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102258475 NA 7.33E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251