\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101880727:

Variant ID: vg0101880727 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1880727
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGGTGGGGTCCACGTGGGCCCCACCATTTTCTATTATTGTGTGGGTGAAACTGACATGTGGGCCTCATAGGTTTTATTATTTTTGGAATCAAATTGA[C/G,T]
ATGTAAGCGCCACGTCAATGCCACGTCAGATGAAGACCGAGTCAACTTAGTCACGTAGGCGCCACCTCAGCCAAAACCGGGGTCAAATACTGCCGAGGGA

Reverse complement sequence

TCCCTCGGCAGTATTTGACCCCGGTTTTGGCTGAGGTGGCGCCTACGTGACTAAGTTGACTCGGTCTTCATCTGACGTGGCATTGACGTGGCGCTTACAT[G/C,A]
TCAATTTGATTCCAAAAATAATAAAACCTATGAGGCCCACATGTCAGTTTCACCCACACAATAATAGAAAATGGTGGGGCCCACGTGGACCCCACCTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 1.00% 0.30% 0.00% T: 0.11%
All Indica  2759 99.90% 0.00% 0.04% 0.00% T: 0.04%
All Japonica  1512 96.50% 2.90% 0.60% 0.00% NA
Aus  269 97.80% 0.00% 0.74% 0.00% T: 1.49%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.13% 0.00% T: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 89.90% 8.70% 1.39% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101880727 C -> G LOC_Os01g04250.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:76.081; most accessible tissue: Callus, score: 97.299 N N N N
vg0101880727 C -> G LOC_Os01g04250-LOC_Os01g04260 intergenic_region ; MODIFIER silent_mutation Average:76.081; most accessible tissue: Callus, score: 97.299 N N N N
vg0101880727 C -> T LOC_Os01g04250.1 downstream_gene_variant ; 824.0bp to feature; MODIFIER silent_mutation Average:76.081; most accessible tissue: Callus, score: 97.299 N N N N
vg0101880727 C -> T LOC_Os01g04250-LOC_Os01g04260 intergenic_region ; MODIFIER silent_mutation Average:76.081; most accessible tissue: Callus, score: 97.299 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101880727 5.50E-07 NA mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101880727 7.72E-09 NA mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101880727 1.29E-06 NA mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101880727 1.53E-06 NA mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251