\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101639997:

Variant ID: vg0101639997 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1639997
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CACGACTTAGACTCTCACTCAAAGAACGAAATTTTTGCATATAGGATTTTGCCGAATTAGTTTTTAACGTCACGCAAAAAGCGGAGCGTTACATTTCCCT[A/G]
CCGCTCGCCGCTGCGAGGGATGGGGAGAAGTCGCGCCAACGCCGCAGCACATCGCCGAGCGTGGAGTGTTCGGAGAAATAGAGGGGAGAAAGGGGTTGAC

Reverse complement sequence

GTCAACCCCTTTCTCCCCTCTATTTCTCCGAACACTCCACGCTCGGCGATGTGCTGCGGCGTTGGCGCGACTTCTCCCCATCCCTCGCAGCGGCGAGCGG[T/C]
AGGGAAATGTAACGCTCCGCTTTTTGCGTGACGTTAAAAACTAATTCGGCAAAATCCTATATGCAAAAATTTCGTTCTTTGAGTGAGAGTCTAAGTCGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 47.30% 0.02% 0.00% NA
All Indica  2759 56.50% 43.50% 0.00% 0.00% NA
All Japonica  1512 53.50% 46.50% 0.00% 0.00% NA
Aus  269 6.30% 93.30% 0.37% 0.00% NA
Indica I  595 80.80% 19.20% 0.00% 0.00% NA
Indica II  465 12.00% 88.00% 0.00% 0.00% NA
Indica III  913 67.10% 32.90% 0.00% 0.00% NA
Indica Intermediate  786 51.90% 48.10% 0.00% 0.00% NA
Temperate Japonica  767 90.70% 9.30% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 36.90% 63.10% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101639997 A -> G LOC_Os01g03860.1 downstream_gene_variant ; 961.0bp to feature; MODIFIER silent_mutation Average:71.893; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N
vg0101639997 A -> G LOC_Os01g03870.1 downstream_gene_variant ; 1237.0bp to feature; MODIFIER silent_mutation Average:71.893; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N
vg0101639997 A -> G LOC_Os01g03860-LOC_Os01g03870 intergenic_region ; MODIFIER silent_mutation Average:71.893; most accessible tissue: Zhenshan97 root, score: 85.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101639997 NA 4.48E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.06E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.55E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 2.07E-12 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.51E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 9.25E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 2.12E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 4.54E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 9.07E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 2.38E-06 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 7.96E-08 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 6.14E-11 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.92E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 7.80E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.00E-13 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 9.29E-10 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 6.57E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 3.59E-13 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.01E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 7.46E-07 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 3.92E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 1.97E-08 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 3.27E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 5.17E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101639997 NA 4.23E-08 mr1892_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251