\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101399336:

Variant ID: vg0101399336 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1399336
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGAAAGTTTTTAAATTTGAGTCGAATGTTTTCAAATTTTGAGTTGAAAATTTTCAAATTTGACTTGAAAGTATTCAAATATGGGTTGAAAGTTTTCA[G/A,T]
ATTTGACTTGAAAGTTTTCAAATATGGGTTGAAAGTATTCAAATCTGAGTTGAAAGTTTTAAATTTGAGTTGAAAGTTTTTCAAATTTGAGATGAAAAGT

Reverse complement sequence

ACTTTTCATCTCAAATTTGAAAAACTTTCAACTCAAATTTAAAACTTTCAACTCAGATTTGAATACTTTCAACCCATATTTGAAAACTTTCAAGTCAAAT[C/T,A]
TGAAAACTTTCAACCCATATTTGAATACTTTCAAGTCAAATTTGAAAATTTTCAACTCAAAATTTGAAAACATTCGACTCAAATTTAAAAACTTTCAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 35.60% 0.55% 5.61% T: 0.19%
All Indica  2759 43.00% 56.50% 0.51% 0.00% NA
All Japonica  1512 75.40% 6.50% 0.60% 17.46% NA
Aus  269 96.30% 0.00% 0.74% 0.00% T: 2.97%
Indica I  595 24.00% 75.10% 0.84% 0.00% NA
Indica II  465 71.40% 28.00% 0.65% 0.00% NA
Indica III  913 35.00% 64.80% 0.11% 0.00% NA
Indica Intermediate  786 49.70% 49.60% 0.64% 0.00% NA
Temperate Japonica  767 59.30% 12.50% 0.78% 27.38% NA
Tropical Japonica  504 98.20% 0.40% 0.40% 0.99% NA
Japonica Intermediate  241 78.80% 0.40% 0.41% 20.33% NA
VI/Aromatic  96 91.70% 6.20% 1.04% 0.00% T: 1.04%
Intermediate  90 80.00% 18.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101399336 G -> T LOC_Os01g03452.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> T LOC_Os01g03464.1 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> T LOC_Os01g03490.1 upstream_gene_variant ; 4819.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> T LOC_Os01g03480.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> T LOC_Os01g03464-LOC_Os01g03480 intergenic_region ; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> A LOC_Os01g03452.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> A LOC_Os01g03464.1 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> A LOC_Os01g03490.1 upstream_gene_variant ; 4819.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> A LOC_Os01g03480.1 downstream_gene_variant ; 2168.0bp to feature; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> A LOC_Os01g03464-LOC_Os01g03480 intergenic_region ; MODIFIER silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N
vg0101399336 G -> DEL N N silent_mutation Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101399336 NA 8.36E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.98E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.69E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.46E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.74E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 4.49E-15 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.40E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 5.99E-13 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.89E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 8.25E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.09E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 7.36E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 9.64E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 7.03E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.12E-16 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 7.19E-14 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 9.81E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 9.19E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 9.94E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.86E-13 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 6.12E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.21E-15 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.11E-12 mr1726 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 3.29E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 8.45E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.52E-13 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 9.48E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.17E-18 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.66E-17 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 4.03E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.98E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 3.00E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 6.87E-19 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 5.93E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.62E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.21E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 1.73E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 5.25E-08 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 5.30E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 6.51E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 2.81E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336 NA 4.34E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251