Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101399336:

Variant ID: vg0101399336 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1399336
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, G: 0.40, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTGAAAGTTTTTAAATTTGAGTCGAATGTTTTCAAATTTTGAGTTGAAAATTTTCAAATTTGACTTGAAAGTATTCAAATATGGGTTGAAAGTTTTCA[G/A,T]
ATTTGACTTGAAAGTTTTCAAATATGGGTTGAAAGTATTCAAATCTGAGTTGAAAGTTTTAAATTTGAGTTGAAAGTTTTTCAAATTTGAGATGAAAAGT

Reverse complement sequence

ACTTTTCATCTCAAATTTGAAAAACTTTCAACTCAAATTTAAAACTTTCAACTCAGATTTGAATACTTTCAACCCATATTTGAAAACTTTCAAGTCAAAT[C/T,A]
TGAAAACTTTCAACCCATATTTGAATACTTTCAAGTCAAATTTGAAAATTTTCAACTCAAAATTTGAAAACATTCGACTCAAATTTAAAAACTTTCAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	35.60%	0.55%	5.61%	T: 0.19%
All Indica	2759	43.00%	56.50%	0.51%	0.00%	NA
All Japonica	1512	75.40%	6.50%	0.60%	17.46%	NA
Aus	269	96.30%	0.00%	0.74%	0.00%	T: 2.97%
Indica I	595	24.00%	75.10%	0.84%	0.00%	NA
Indica II	465	71.40%	28.00%	0.65%	0.00%	NA
Indica III	913	35.00%	64.80%	0.11%	0.00%	NA
Indica Intermediate	786	49.70%	49.60%	0.64%	0.00%	NA
Temperate Japonica	767	59.30%	12.50%	0.78%	27.38%	NA
Tropical Japonica	504	98.20%	0.40%	0.40%	0.99%	NA
Japonica Intermediate	241	78.80%	0.40%	0.41%	20.33%	NA
VI/Aromatic	96	91.70%	6.20%	1.04%	0.00%	T: 1.04%
Intermediate	90	80.00%	18.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101399336	G -> T	LOC_Os01g03452.1	upstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> T	LOC_Os01g03464.1	upstream_gene_variant ; 2567.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> T	LOC_Os01g03490.1	upstream_gene_variant ; 4819.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> T	LOC_Os01g03480.1	downstream_gene_variant ; 2168.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> T	LOC_Os01g03464-LOC_Os01g03480	intergenic_region ; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> A	LOC_Os01g03452.1	upstream_gene_variant ; 4860.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> A	LOC_Os01g03464.1	upstream_gene_variant ; 2567.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> A	LOC_Os01g03490.1	upstream_gene_variant ; 4819.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> A	LOC_Os01g03480.1	downstream_gene_variant ; 2168.0bp to feature; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> A	LOC_Os01g03464-LOC_Os01g03480	intergenic_region ; MODIFIER	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N
vg0101399336	G -> DEL	N	N	silent_mutation	Average:46.71; most accessible tissue: Minghui63 flower, score: 80.178	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101399336	NA	8.36E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.98E-14	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.69E-10	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.46E-08	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.74E-17	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	4.49E-15	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.40E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	5.99E-13	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.89E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	8.25E-07	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.09E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	7.36E-07	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	9.64E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	7.03E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.12E-16	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	7.19E-14	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	9.81E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	9.19E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	9.94E-16	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.86E-13	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	6.12E-06	mr1698	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.21E-15	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.11E-12	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	3.29E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	8.45E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.52E-13	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	9.48E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.17E-18	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.66E-17	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	4.03E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.98E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	3.00E-08	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	6.87E-19	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	5.93E-07	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.62E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.21E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	1.73E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	5.25E-08	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	5.30E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	6.51E-07	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	2.81E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101399336	NA	4.34E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251