\
| Variant ID: vg0101328049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1328049 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGTTTGACCACTTGTCTTATTTAAAATTTTTTGAAATTATTAATTATTTTATTTATGGCTTACTTTATTATCTACAGTATTTTAAGCACAACTTTTCGT[T/G]
TTTTATATTTGTAAAAAAAATTGAATAAGACGAGTGGTCAAACGTTAGAAGCAAAAACCGAAAATCCCTTGTACCGTGGGGCGGAGGGAGTAGTAGAGTT
AACTCTACTACTCCCTCCGCCCCACGGTACAAGGGATTTTCGGTTTTTGCTTCTAACGTTTGACCACTCGTCTTATTCAATTTTTTTTACAAATATAAAA[A/C]
ACGAAAAGTTGTGCTTAAAATACTGTAGATAATAAAGTAAGCCATAAATAAAATAATTAATAATTTCAAAAAATTTTAAATAAGACAAGTGGTCAAACGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 7.40% | 0.36% | 19.11% | NA |
| All Indica | 2759 | 68.50% | 2.90% | 0.58% | 27.94% | NA |
| All Japonica | 1512 | 91.40% | 0.30% | 0.07% | 8.27% | NA |
| Aus | 269 | 11.90% | 87.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 73.90% | 0.00% | 0.67% | 25.38% | NA |
| Indica II | 465 | 95.30% | 0.20% | 0.00% | 4.52% | NA |
| Indica III | 913 | 52.50% | 3.50% | 0.66% | 43.37% | NA |
| Indica Intermediate | 786 | 67.30% | 6.10% | 0.76% | 25.83% | NA |
| Temperate Japonica | 767 | 88.10% | 0.10% | 0.13% | 11.60% | NA |
| Tropical Japonica | 504 | 98.60% | 0.60% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 86.70% | 0.00% | 0.00% | 13.28% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 15.60% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101328049 | T -> G | LOC_Os01g03270.1 | upstream_gene_variant ; 123.0bp to feature; MODIFIER | silent_mutation | Average:58.694; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| vg0101328049 | T -> G | LOC_Os01g03280.1 | downstream_gene_variant ; 2755.0bp to feature; MODIFIER | silent_mutation | Average:58.694; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| vg0101328049 | T -> G | LOC_Os01g03260-LOC_Os01g03270 | intergenic_region ; MODIFIER | silent_mutation | Average:58.694; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| vg0101328049 | T -> DEL | N | N | silent_mutation | Average:58.694; most accessible tissue: Zhenshan97 panicle, score: 87.764 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101328049 | NA | 2.15E-10 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 8.25E-20 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 6.82E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 1.46E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 1.26E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 1.81E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 4.41E-10 | mr1762_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 8.24E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | 2.72E-07 | NA | mr1889_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | 8.22E-06 | NA | mr1894_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | 5.93E-07 | NA | mr1896_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 1.52E-10 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | 6.50E-06 | NA | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 2.21E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101328049 | NA | 9.98E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |