Variant ID: vg0101034362 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 1034362 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.26, others allele: 0.00, population size: 80. )
GAGGGGCTTAGCAGTACGACGAGCAACCCAATACTGTTTATAATTTAAATTTAAAAAATGGTGAGACGAGTACTCCCTCCATCACTAAATATTTAACGCC[A/G]
TTAAGTTTTTTAAACATGTTTGACCGTCCGTCTTATTAAAAAAGTTTAAGTAATTATTTATTCTTTTCCTATCATTTGATTCATTATTAAATATACTACT
AGTAGTATATTTAATAATGAATCAAATGATAGGAAAAGAATAAATAATTACTTAAACTTTTTTAATAAGACGGACGGTCAAACATGTTTAAAAAACTTAA[T/C]
GGCGTTAAATATTTAGTGATGGAGGGAGTACTCGTCTCACCATTTTTTAAATTTAAATTATAAACAGTATTGGGTTGCTCGTCGTACTGCTAAGCCCCTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 84.30% | 15.70% | 0.02% | 0.00% | NA |
All Indica | 2759 | 96.80% | 3.20% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 57.70% | 42.30% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 90.80% | 9.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 43.50% | 56.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 38.20% | 61.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0101034362 | A -> G | LOC_Os01g02884.1 | downstream_gene_variant ; 4250.0bp to feature; MODIFIER | silent_mutation | Average:50.595; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
vg0101034362 | A -> G | LOC_Os01g02884-LOC_Os01g02890 | intergenic_region ; MODIFIER | silent_mutation | Average:50.595; most accessible tissue: Minghui63 root, score: 75.155 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0101034362 | 2.05E-06 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101034362 | 4.62E-09 | NA | mr1354_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101034362 | 1.91E-06 | NA | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101034362 | 2.27E-08 | NA | mr1829_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0101034362 | 1.30E-09 | NA | mr1902_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |