Variant ID: vg0100183346 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 183346 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 104. )
TCGATTTCTAATCAGTATATATCTCTTCTCTATCTCTAATCTAATCTAACTATTTAAAAAAAGAAAATGCACGAGAAAAATAAAAACGGTTCAAAAAAAT[A/G]
CGTGAGAAAAAAGCGCAAAAAAATGCTAAAAAGGTTTTCCATCTTCCATTAAAAAAACGTGCAAGAAATATTATTTCCATCGTCGGTAAATTTTTTAAAA
TTTTAAAAAATTTACCGACGATGGAAATAATATTTCTTGCACGTTTTTTTAATGGAAGATGGAAAACCTTTTTAGCATTTTTTTGCGCTTTTTTCTCACG[T/C]
ATTTTTTTGAACCGTTTTTATTTTTCTCGTGCATTTTCTTTTTTTAAATAGTTAGATTAGATTAGAGATAGAGAAGAGATATATACTGATTAGAAATCGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 75.80% | 23.70% | 0.47% | 0.00% | NA |
All Indica | 2759 | 69.80% | 29.50% | 0.69% | 0.00% | NA |
All Japonica | 1512 | 97.60% | 2.30% | 0.07% | 0.00% | NA |
Aus | 269 | 10.80% | 88.50% | 0.74% | 0.00% | NA |
Indica I | 595 | 30.90% | 68.60% | 0.50% | 0.00% | NA |
Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
Indica III | 913 | 85.20% | 13.70% | 1.10% | 0.00% | NA |
Indica Intermediate | 786 | 65.60% | 33.70% | 0.64% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0100183346 | A -> G | LOC_Os01g01360.1 | downstream_gene_variant ; 2534.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Callus, score: 25.794 | N | N | N | N |
vg0100183346 | A -> G | LOC_Os01g01369.1 | downstream_gene_variant ; 2900.0bp to feature; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Callus, score: 25.794 | N | N | N | N |
vg0100183346 | A -> G | LOC_Os01g01360-LOC_Os01g01369 | intergenic_region ; MODIFIER | silent_mutation | Average:18.133; most accessible tissue: Callus, score: 25.794 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0100183346 | NA | 6.72E-10 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0100183346 | NA | 7.49E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0100183346 | NA | 7.75E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0100183346 | 2.02E-08 | NA | mr1718_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0100183346 | 4.89E-06 | NA | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |