15 variations found. Os10g0326100/LOC_Os10g17890 (OsWAK113 - OsWAK receptor-like protein OsWAK-RLP; expressed), ranging from 9,041,959 bp to 9,042,871 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Gene ID | Annotation |
|---|---|
| LOC_Os10g17890 | OsWAK113 - OsWAK receptor-like protein OsWAK-RLP; RAP ID: Os10g0326100; MSU ID: LOC_Os10g17890 |
| MSU ID | RAP ID | Symbol | Name | Explanation | Recommended Gene Symbol | Recommended Gene Name |
|---|---|---|---|---|---|---|
| LOC_Os10g17890 | Os10g0326100 | OsWAK113 | WAK113 | WALL-ASSOCIATED KINASE GENE 113 |
The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg1009042223 (J) | chr10 | 9042223 | G | A | 79.00% | 0.00% | G -> A |
mr1027 (Ind_All); LMM P-value: 8.51E-06; LR P-value: 8.51E-06;
mr1709 (All); LR P-value: 3.38E-14; mr1709 (Ind_All); LR P-value: 1.57E-11; mr1027_2 (All); LMM P-value: 1.75E-06; mr1027_2 (Ind_All); LMM P-value: 2.38E-06; LR P-value: 4.45E-09; mr1580_2 (Ind_All); LR P-value: 6.16E-06; mr1709_2 (All); LR P-value: 6.94E-12; mr1709_2 (Ind_All); LR P-value: 1.26E-10; mr1825_2 (Ind_All); LR P-value: 9.64E-06 |
LOC_Os10g17890.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 85.106; most accessible tissue: Zhenshan97 young leaf, score: 93.722 |
| vg1009042297 (J) | chr10 | 9042297 | G | GC | 99.40% | 0.00% | G -> GC | NA |
LOC_Os10g17890.1 Alt: GC| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar)
The average chromatin accessibility score: 85.311; most accessible tissue: Zhenshan97 young leaf, score: 94.523 |
| vg1009042323 (J) | chr10 | 9042323 | G | T | 93.80% | 0.00% | G -> T |
mr1062 (Jap_All); LR P-value: 1.25E-06;
mr1210 (Jap_All); LR P-value: 1.85E-07; mr1300 (All); LMM P-value: 1.68E-07; mr1300 (Jap_All); LR P-value: 2.19E-06; mr1305 (Jap_All); LR P-value: 4.30E-08; mr1585 (Jap_All); LR P-value: 2.39E-08; mr1586 (Jap_All); LR P-value: 2.04E-07; mr1765 (Jap_All); LR P-value: 3.17E-06; mr1922 (Jap_All); LR P-value: 7.03E-06; mr1305_2 (Jap_All); LR P-value: 1.94E-06; mr1585_2 (All); LMM P-value: 4.83E-06; LR P-value: 6.59E-08; mr1585_2 (Jap_All); LR P-value: 9.24E-10 |
LOC_Os10g17890.1 Alt: T| stop_gained HIGH(snpEff)/stop_gained(CooVar)
The average chromatin accessibility score: 85.021; most accessible tissue: Zhenshan97 young leaf, score: 94.554 |
| vg1009042411 (J) | chr10 | 9042411 | G | A | 79.00% | 0.00% | G -> A |
mr1027 (Ind_All); LMM P-value: 8.73E-06; LR P-value: 8.73E-06;
mr1709 (All); LR P-value: 7.54E-14; mr1709 (Ind_All); LR P-value: 2.32E-11; mr1027_2 (Ind_All); LMM P-value: 2.56E-06; LR P-value: 5.18E-09; mr1580_2 (Ind_All); LR P-value: 6.27E-06; mr1709_2 (All); LR P-value: 1.27E-11; mr1709_2 (Ind_All); LR P-value: 1.68E-10 |
LOC_Os10g17890.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 84.690; most accessible tissue: Zhenshan97 young leaf, score: 94.791 |
| vg1009042456 (J) | chr10 | 9042456 | G | A | 91.50% | 0.00% | G -> A | NA |
LOC_Os10g17890.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
The average chromatin accessibility score: 86.558; most accessible tissue: Zhenshan97 young leaf, score: 95.007 |
| vg1009042479 (J) | chr10 | 9042479 | G | A | 99.30% | 0.00% | G -> A | NA |
LOC_Os10g17890.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 86.619; most accessible tissue: Zhenshan97 young leaf, score: 94.875 |
| vg1009042523 (J) | chr10 | 9042523 | GC | AC | 79.70% | 0.00% | AC -> GC,A |
mr1047 (Jap_All); LR P-value: 2.85E-06;
mr1118 (Jap_All); LR P-value: 3.46E-07; mr1156 (All); LR P-value: 4.70E-15; mr1300 (All); LR P-value: 5.63E-24; mr1310 (All); LR P-value: 1.96E-39; mr1310 (Jap_All); LR P-value: 9.98E-08; mr1328 (Jap_All); LR P-value: 5.17E-06; mr1446 (Jap_All); LR P-value: 8.52E-06; mr1471 (All); LR P-value: 3.23E-10; mr1486 (All); LR P-value: 2.95E-36; mr1495 (Jap_All); LR P-value: 4.37E-06; mr1533 (All); LR P-value: 4.38E-36; mr1580 (Jap_All); LR P-value: 5.36E-10; mr1624 (All); LR P-value: 5.77E-08; mr1642 (Jap_All); LR P-value: 2.01E-06; mr1679 (All); LR P-value: 2.28E-22; mr1679 (Jap_All); LR P-value: 2.66E-09; mr1691 (All); LR P-value: 3.92E-10; mr1693 (All); LR P-value: 1.73E-10; mr1693 (Jap_All); LR P-value: 1.57E-06; mr1768 (All); LR P-value: 3.04E-20; mr1870 (Jap_All); LR P-value: 9.55E-07; mr1926 (All); LR P-value: 5.68E-43; mr1926 (Jap_All); LR P-value: 8.70E-08; mr1959 (All); LR P-value: 2.41E-09; mr1980 (All); LR P-value: 3.16E-36; mr1980 (Jap_All); LR P-value: 6.94E-11; mr1118_2 (Jap_All); LR P-value: 3.67E-06; mr1310_2 (All); LR P-value: 4.43E-34; mr1310_2 (Jap_All); LR P-value: 2.43E-07; mr1398_2 (Jap_All); LR P-value: 8.83E-06; mr1495_2 (Jap_All); LR P-value: 1.77E-07; mr1533_2 (All); LR P-value: 3.07E-41; mr1679_2 (All); LR P-value: 6.03E-21; mr1682_2 (All); LR P-value: 5.23E-18; mr1733_2 (Jap_All); LR P-value: 6.49E-07; mr1768_2 (All); LR P-value: 2.38E-28; mr1800_2 (All); LR P-value: 2.39E-13; mr1959_2 (All); LR P-value: 2.11E-15; mr1980_2 (All); LR P-value: 6.59E-18; mr1991_2 (Jap_All); LR P-value: 6.68E-07 |
LOC_Os10g17890.1 Alt: GC| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os10g17890.1 Alt: A| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) The average chromatin accessibility score: 86.073; most accessible tissue: Zhenshan97 young leaf, score: 94.392 |
| vg1009042596 (J) | chr10 | 9042596 | G | GTCGAA | 99.20% | 0.00% | G -> GTCGAA,GTC GAAACATGAA TTCGGC,GTC GAAACATGAA TTCGGCAATA | NA |
LOC_Os10g17890.1 Alt: GTCGAAACATGAATTCGGCAATA| frameshift_variant&stop_gained HIGH(snpEff)/frameshift_variant(CooVar)
LOC_Os10g17890.1 Alt: GTCGAAACATGAATTCGGC| stop_gained&disruptive_inframe_insertion HIGH(snpEff)/inframe_variant(CooVar) LOC_Os10g17890.1 Alt: GTCGAA| frameshift_variant HIGH(snpEff)/frameshift_variant(CooVar) The average chromatin accessibility score: 83.758; most accessible tissue: Zhenshan97 young leaf, score: 93.416 |
| vg1009042600 (J) | chr10 | 9042600 | AC | A | 99.60% | 0.00% | AC -> A,AATAAAAG GGGGTAGC | NA |
LOC_Os10g17890.1 Alt: AATAAAAGGGGGTAGC| frameshift_variant&stop_gained HIGH(snpEff)
LOC_Os10g17880.1 Alt: AATAAAAGGGGGTAGC| upstream_gene_variant MODIFIER(snpEff) LOC_Os10g17890.1 Alt: A| frameshift_variant HIGH(snpEff) LOC_Os10g17880.1 Alt: A| upstream_gene_variant MODIFIER(snpEff) LOC_Os10g17900.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 83.761; most accessible tissue: Zhenshan97 young leaf, score: 93.324 |
| vg1009042703 (J) | chr10 | 9042703 | C | A | 97.40% | 0.00% | C -> A | NA |
LOC_Os10g17890.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 84.442; most accessible tissue: Zhenshan97 young leaf, score: 91.151 |
| vg1009042786 (J) | chr10 | 9042786 | C | G | 98.90% | 0.00% | C -> G | NA |
LOC_Os10g17890.1 Alt: G| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
The average chromatin accessibility score: 81.000; most accessible tissue: Zhenshan97 young leaf, score: 87.723 |
| vg1009042838 (J) | chr10 | 9042838 | C | T | 98.40% | 0.00% | C -> T | NA |
LOC_Os10g17890.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 75.564; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 |
| vg1009042839 (J) | chr10 | 9042839 | G | T | 79.50% | 0.00% | G -> T |
mr1026 (All); LMM P-value: 1.38E-09; LR P-value: 1.62E-41;
mr1026 (Ind_All); LMM P-value: 1.47E-09; LR P-value: 1.06E-22; mr1113 (Ind_All); LR P-value: 1.04E-07; mr1114 (Ind_All); LR P-value: 3.03E-07; mr1116 (Ind_All); LR P-value: 3.09E-06; mr1118 (All); LMM P-value: 9.49E-08; LR P-value: 2.60E-19; mr1118 (Ind_All); LMM P-value: 1.80E-11; LR P-value: 6.20E-23; mr1120 (Ind_All); LR P-value: 3.54E-06; mr1161 (All); LMM P-value: 4.64E-09; LR P-value: 8.56E-39; mr1161 (Ind_All); LMM P-value: 2.41E-09; LR P-value: 4.38E-21; mr1495 (All); LMM P-value: 6.19E-09; LR P-value: 3.21E-26; mr1495 (Ind_All); LMM P-value: 1.86E-11; LR P-value: 2.42E-28; mr1496 (Ind_All); LR P-value: 9.37E-11; mr1794 (Ind_All); LR P-value: 2.52E-11; mr1936 (Ind_All); LR P-value: 2.60E-06; mr1114_2 (Ind_All); LR P-value: 6.38E-06; mr1118_2 (All); LMM P-value: 2.98E-07; LR P-value: 6.99E-24; mr1118_2 (Ind_All); LMM P-value: 1.19E-12; LR P-value: 3.55E-31; mr1120_2 (Ind_All); LR P-value: 5.33E-08; mr1123_2 (Ind_All); LR P-value: 7.72E-09; mr1161_2 (All); LMM P-value: 1.89E-12; LR P-value: 1.42E-43; mr1161_2 (Ind_All); LMM P-value: 1.42E-12; LR P-value: 4.57E-25; mr1242_2 (Ind_All); LR P-value: 4.94E-07; mr1247_2 (Ind_All); LR P-value: 5.99E-06; mr1495_2 (All); LMM P-value: 3.71E-09; LR P-value: 5.68E-34; mr1495_2 (Ind_All); LMM P-value: 3.78E-12; LR P-value: 2.46E-33; mr1496_2 (Ind_All); LR P-value: 3.34E-12; mr1531_2 (Ind_All); LR P-value: 3.74E-08; mr1580_2 (Ind_All); LMM P-value: 8.33E-06; LR P-value: 1.80E-06; mr1655_2 (All); LR P-value: 6.85E-06; mr1794_2 (Ind_All); LMM P-value: 2.34E-06; LR P-value: 1.51E-16; mr1825_2 (Ind_All); LMM P-value: 3.33E-06; LR P-value: 1.27E-06; mr1870_2 (Ind_All); LR P-value: 2.46E-06; mr1904_2 (All); LR P-value: 8.04E-13; mr1904_2 (Ind_All); LR P-value: 9.50E-08; mr1936_2 (Ind_All); LR P-value: 3.67E-12; mr1961_2 (Ind_All); LR P-value: 8.54E-07; mr1962_2 (Ind_All); LR P-value: 1.61E-08 |
LOC_Os10g17890.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/possibly damaging(PolyPhen-2)
The average chromatin accessibility score: 75.564; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 |
| vg1009042842 (J) | chr10 | 9042842 | T | C | 93.80% | 0.00% | T -> C |
mr1062 (Jap_All); LR P-value: 1.25E-06;
mr1210 (Jap_All); LR P-value: 1.85E-07; mr1300 (All); LMM P-value: 1.68E-07; mr1300 (Jap_All); LR P-value: 2.19E-06; mr1305 (Jap_All); LR P-value: 4.30E-08; mr1585 (Jap_All); LR P-value: 2.39E-08; mr1586 (Jap_All); LR P-value: 2.04E-07; mr1765 (Jap_All); LR P-value: 3.17E-06; mr1922 (Jap_All); LR P-value: 7.03E-06; mr1305_2 (Jap_All); LR P-value: 1.94E-06; mr1585_2 (All); LMM P-value: 4.83E-06; LR P-value: 6.59E-08; mr1585_2 (Jap_All); LR P-value: 9.24E-10 |
LOC_Os10g17890.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 75.346; most accessible tissue: Zhenshan97 flag leaf, score: 83.684 |
| vg1009042846 (J) | chr10 | 9042846 | C | T | 94.20% | 0.00% | C -> T | NA |
LOC_Os10g17890.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 75.032; most accessible tissue: Minghui63 flag leaf, score: 83.412 |