28 variations found. Os03g0379700/LOC_Os03g26250 (expressed protein), ranging from 15,011,161 bp to 15,011,736 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Gene ID | Annotation |
|---|---|
| LOC_Os03g26250 | conserved hypothetical protein; RAP ID: Os03g0379700; MSU ID: LOC_Os03g26250 |
The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0315011173 (J) | chr03 | 15011173 | G | A | 99.60% | 0.00% | G -> A | NA |
LOC_Os03g26250.1 Alt: A| synonymous_variant LOW(snpEff)
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 66.620; most accessible tissue: Minghui63 root, score: 82.511 |
| vg0315011284 (J) | chr03 | 15011284 | G | A | 77.20% | 0.00% | G -> A |
mr1082 (Jap_All); LR P-value: 2.47E-06;
mr1083 (Jap_All); LR P-value: 1.13E-06; mr1088 (Ind_All); LR P-value: 9.25E-06; mr1217 (Jap_All); LR P-value: 1.03E-07; mr1237 (Ind_All); LR P-value: 4.05E-08; mr1526 (Ind_All); LR P-value: 8.37E-07; mr1560 (Jap_All); LR P-value: 9.11E-06; mr1634 (Ind_All); LR P-value: 8.00E-06; mr1852 (Jap_All); LR P-value: 4.42E-08 |
LOC_Os03g26250.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 70.461; most accessible tissue: Callus, score: 84.841 |
| vg0315011318 (J) | chr03 | 15011318 | C | T | 85.50% | 0.00% | C -> T |
mr1045 (All); LR P-value: 2.26E-08;
mr1045 (Jap_All); LR P-value: 2.90E-07; mr1072 (Jap_All); LR P-value: 8.00E-06; mr1077 (All); LR P-value: 1.45E-18; mr1077 (Jap_All); LR P-value: 1.75E-07; mr1202 (Jap_All); LR P-value: 8.02E-07; mr1330 (Jap_All); LR P-value: 7.13E-10; mr1521 (Jap_All); LR P-value: 5.71E-07; mr1530 (Jap_All); LR P-value: 6.72E-07; mr1576 (All); LR P-value: 2.76E-07; mr1576 (Jap_All); LR P-value: 7.71E-06; mr1627 (Jap_All); LR P-value: 2.17E-06; mr1629 (Jap_All); LR P-value: 1.13E-06; mr1668 (Jap_All); LR P-value: 1.56E-06; mr1703 (All); LMM P-value: 3.63E-07; LR P-value: 3.62E-07; mr1703 (Jap_All); LMM P-value: 2.15E-06; LR P-value: 2.15E-06; mr1729 (Jap_All); LR P-value: 1.88E-06; mr1804 (All); LR P-value: 8.24E-08; mr1844 (All); LR P-value: 6.56E-13; mr1844 (Jap_All); LR P-value: 3.57E-06; mr1865 (Jap_All); LR P-value: 4.62E-07; mr1880 (All); LR P-value: 2.20E-06; mr1977 (All); LR P-value: 1.01E-07; mr1977 (Jap_All); LR P-value: 4.48E-06; mr1982 (All); LR P-value: 1.91E-13; mr1182_2 (All); LR P-value: 1.41E-14; mr1182_2 (Jap_All); LR P-value: 2.53E-07; mr1282_2 (All); LR P-value: 3.42E-10; mr1530_2 (Jap_All); LR P-value: 2.78E-10 |
LOC_Os03g26250.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/probably damaging(PolyPhen-2)
The average chromatin accessibility score: 70.414; most accessible tissue: Callus, score: 84.841 |
| vg0315011365 (J) | chr03 | 15011365 | C | T | 79.20% | 0.00% | C -> T,G |
LOC_Os03g26250.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os03g26250.1 Alt: G| synonymous_variant LOW(snpEff) LOC_Os03g26240.1 Alt: G| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26260.1 Alt: G| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: G| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 67.981; most accessible tissue: Minghui63 root, score: 82.967 |
|
| vg0315011380 (J) | chr03 | 15011380 | C | T | 98.20% | 0.00% | C -> T | NA |
LOC_Os03g26250.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 67.408; most accessible tissue: Minghui63 root, score: 82.818 |
| vg0315011440 (J) | chr03 | 15011440 | G | A | 99.10% | 0.74% | G -> A | NA |
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 62.408; most accessible tissue: Minghui63 root, score: 79.068 |
| vg0315011446 (J) | chr03 | 15011446 | A | AT | 99.10% | 0.00% | A -> AT | NA |
LOC_Os03g26240.1 Alt: AT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: AT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: AT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: AT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 62.065; most accessible tissue: Callus, score: 78.971 |
| vg0315011458 (J) | chr03 | 15011458 | C | T | 92.70% | 0.00% | T -> C | NA |
LOC_Os03g26240.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 61.981; most accessible tissue: Callus, score: 78.971 |
| vg0315011459 (J) | chr03 | 15011459 | G | A | 96.90% | 0.00% | A -> G | NA |
LOC_Os03g26240.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 61.981; most accessible tissue: Callus, score: 78.971 |
| vg0315011468 (J) | chr03 | 15011468 | C | T | 96.90% | 0.00% | T -> C | NA |
LOC_Os03g26240.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 61.154; most accessible tissue: Callus, score: 78.971 |
| vg0315011508 (J) | chr03 | 15011508 | C | T | 99.70% | 0.00% | C -> T | NA |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 58.812; most accessible tissue: Callus, score: 78.971 |
| vg0315011511 (J) | chr03 | 15011511 | C | T | 76.90% | 0.00% | C -> T |
mr1082 (Jap_All); LR P-value: 2.47E-06;
mr1083 (Jap_All); LR P-value: 1.13E-06; mr1217 (Jap_All); LR P-value: 1.03E-07; mr1237 (Ind_All); LR P-value: 5.09E-08; mr1526 (Ind_All); LR P-value: 1.22E-06; mr1560 (Jap_All); LR P-value: 9.11E-06; mr1634 (Ind_All); LR P-value: 3.05E-06; mr1852 (Jap_All); LR P-value: 4.42E-08 |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 59.174; most accessible tissue: Callus, score: 78.971 |
| vg0315011517 (J) | chr03 | 15011517 | C | T | 79.10% | 0.00% | C -> T |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 58.735; most accessible tissue: Callus, score: 78.971 |
|
| vg0315011523 (J) | chr03 | 15011523 | ATTT | TTTT | 79.10% | 0.00% | ATTT -> TTTT,A |
mr1077 (All); LR P-value: 1.67E-18;
mr1330 (Jap_All); LR P-value: 3.46E-06; mr1448 (Jap_All); LR P-value: 6.00E-06; mr1549 (Jap_All); LR P-value: 8.20E-09; mr1575 (All); LR P-value: 9.30E-09; mr1757 (Jap_All); LR P-value: 7.92E-08; mr1090_2 (Jap_All); LR P-value: 2.63E-07; mr1096_2 (Jap_All); LR P-value: 1.39E-06 |
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26240.1 Alt: TTTT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26260.1 Alt: TTTT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: TTTT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: TTTT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 58.935; most accessible tissue: Callus, score: 78.971 |
| vg0315011536 (J) | chr03 | 15011536 | A | G | 97.80% | 0.00% | A -> G | NA |
LOC_Os03g26240.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 59.121; most accessible tissue: Callus, score: 78.971 |
| vg0315011608 (J) | chr03 | 15011608 | G | A | 99.80% | 0.00% | G -> A | NA |
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)
LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g26250.1 Alt: A| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 48.961; most accessible tissue: Minghui63 panicle, score: 64.459 |
| vg0315011619 (J) | chr03 | 15011619 | G | A | 50.40% | 0.00% | G -> A |
Grain_length (Jap_All); LR P-value: 1.26E-14;
mr1088 (Jap_All); LR P-value: 7.94E-07; mr1104 (Jap_All); LR P-value: 2.84E-06; mr1179 (Jap_All); LR P-value: 1.50E-06; mr1213 (Jap_All); LR P-value: 8.12E-06; mr1236 (Jap_All); LR P-value: 5.59E-06; mr1502 (Jap_All); LR P-value: 3.36E-06; mr1620 (Jap_All); LR P-value: 3.06E-07; mr1769 (Jap_All); LR P-value: 8.42E-13; mr1422_2 (Jap_All); LR P-value: 2.38E-07; mr1533_2 (Jap_All); LR P-value: 7.00E-12; mr1583_2 (Jap_All); LR P-value: 2.50E-06 |
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 48.956; most accessible tissue: Zhenshan97 panicle, score: 65.386 |
| vg0315011627 (J) | chr03 | 15011627 | C | T | 99.90% | 0.00% | C -> T | NA |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 47.736; most accessible tissue: Zhenshan97 panicle, score: 65.386 |
| vg0315011628 (J) | chr03 | 15011628 | G | A | 96.80% | 0.00% | A -> G | NA |
LOC_Os03g26240.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 47.736; most accessible tissue: Zhenshan97 panicle, score: 65.386 |
| vg0315011642 (J) | chr03 | 15011642 | G | A | 97.60% | 0.00% | G -> A |
LOC_Os03g26240.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 40.430; most accessible tissue: Zhenshan97 panicle, score: 59.590 |
|
| vg0315011650 (J) | chr03 | 15011650 | A | T | 99.20% | 0.00% | A -> T | NA |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 39.847; most accessible tissue: Minghui63 panicle, score: 62.157 |
| vg0315011651 (J) | chr03 | 15011651 | A | G | 99.20% | 0.00% | A -> G | NA |
LOC_Os03g26240.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)
LOC_Os03g26260.1 Alt: G| upstream_gene_variant MODIFIER(snpEff) LOC_Os03g26229.1 Alt: G| downstream_gene_variant MODIFIER(snpEff) LOC_Os03g26250.1 Alt: G| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 39.337; most accessible tissue: Minghui63 panicle, score: 62.157 |
| vg0315011654 (J) | chr03 | 15011654 | CAACGGC GTCATCT ATTAAAA | TAACGGC GTCATCT ATTAAAA | 92.00% | 0.00% | CAACGGCGTC ATCTATTAAA A -> TAACGGCGTC ATCTATTAAA A,C | NA |
LOC_Os03g26240.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26240.1 Alt: TAACGGCGTCATCTATTAAAA| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26260.1 Alt: TAACGGCGTCATCTATTAAAA| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: TAACGGCGTCATCTATTAAAA| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: TAACGGCGTCATCTATTAAAA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 38.710; most accessible tissue: Minghui63 panicle, score: 62.157 |
| vg0315011663 (J) | chr03 | 15011663 | C | T | 51.40% | 0.00% | C -> T |
Grain_length (Jap_All); LR P-value: 1.26E-14;
mr1088 (Jap_All); LR P-value: 7.94E-07; mr1104 (Jap_All); LR P-value: 2.84E-06; mr1179 (Jap_All); LR P-value: 1.50E-06; mr1213 (Jap_All); LR P-value: 8.12E-06; mr1236 (Jap_All); LR P-value: 5.59E-06; mr1502 (Jap_All); LR P-value: 3.36E-06; mr1620 (Jap_All); LR P-value: 3.06E-07; mr1769 (Jap_All); LR P-value: 8.42E-13; mr1422_2 (Jap_All); LR P-value: 2.38E-07; mr1533_2 (Jap_All); LR P-value: 7.00E-12; mr1583_2 (Jap_All); LR P-value: 2.50E-06 |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 39.111; most accessible tissue: Minghui63 panicle, score: 62.157 |
| vg0315011675 (J) | chr03 | 15011675 | A | T | 78.40% | 0.34% | A -> T,ATTTAAT |
LOC_Os03g26240.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26240.1 Alt: ATTTAAT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26260.1 Alt: ATTTAAT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: ATTTAAT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: ATTTAAT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 41.124; most accessible tissue: Callus, score: 67.433 |
|
| vg0315011678 (J) | chr03 | 15011678 | CGGAGGT AGT | TGGAGGT AGT | 97.20% | 0.00% | CGGAGGTAGT -> TGGAGGTAGT ,C | NA |
LOC_Os03g26240.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26240.1 Alt: TGGAGGTAGT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26260.1 Alt: TGGAGGTAGT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: TGGAGGTAGT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: TGGAGGTAGT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 41.230; most accessible tissue: Callus, score: 67.433 |
| vg0315011702 (J) | chr03 | 15011702 | T | C | 98.20% | 0.00% | T -> C | NA |
LOC_Os03g26240.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os03g26260.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26229.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os03g26250.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 41.658; most accessible tissue: Callus, score: 67.433 |
| STR0315011534 (J) | chr03 | 15011534 | ATA | ATG | 92.90% | 0.00% | ATA -> ATG | NA |
|