22 variations found. Os02g0689900/LOC_Os02g46460 (peptide transporter PTR2; putative; expressed), ranging from 28,312,588 bp to 28,316,198 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Gene ID | Annotation |
|---|---|
| LOC_Os02g46460 | peptide transporter PTR2, putative, expressed; RAP ID: Os02g0689900; MSU ID: LOC_Os02g46460 |
The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0228312605 (J) | chr02 | 28312605 | A | T | 96.90% | 0.00% | A -> T | NA |
LOC_Os02g46460.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.2 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 84.249; most accessible tissue: Minghui63 flower, score: 96.513 |
| vg0228312797 (J) | chr02 | 28312797 | TC | T | 99.90% | 0.00% | TC -> T | NA |
LOC_Os02g46460.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os02g46460.2 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff) The average chromatin accessibility score: 92.508; most accessible tissue: Minghui63 flower, score: 98.069 |
| vg0228312874 (J) | chr02 | 28312874 | T | G | 94.40% | 0.00% | T -> G | NA |
LOC_Os02g46460.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.2 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 93.735; most accessible tissue: Minghui63 flower, score: 98.505 |
| vg0228313379 (J) | chr02 | 28313379 | C | T | 51.50% | 0.00% | C -> T |
mr1063 (All); LR P-value: 5.91E-51;
mr1110 (All); LR P-value: 2.77E-35; mr1164 (All); LR P-value: 5.01E-15; mr1200 (All); LR P-value: 2.53E-41; mr1208 (All); LR P-value: 4.38E-30; mr1244 (All); LR P-value: 3.49E-20; mr1063_2 (All); LR P-value: 1.16E-52; mr1110_2 (All); LR P-value: 4.62E-39; mr1164_2 (All); LR P-value: 6.82E-21; mr1244_2 (All); LR P-value: 6.08E-26; mr1260_2 (All); LR P-value: 1.28E-17; mr1580_2 (All); LR P-value: 4.24E-30; mr1728_2 (All); LR P-value: 2.14E-11 |
LOC_Os02g46460.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os02g46460.2 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 96.962; most accessible tissue: Minghui63 panicle, score: 99.334 |
| vg0228313521 (J) | chr02 | 28313521 | C | T | 62.00% | 0.00% | T -> C,G |
mr1342 (All); LR P-value: 1.81E-09;
mr1629 (All); LMM P-value: 1.38E-09; LR P-value: 5.33E-86; mr1905 (All); LMM P-value: 9.47E-06; LR P-value: 1.31E-11; mr1125_2 (All); LR P-value: 9.83E-62; mr1246_2 (All); LR P-value: 3.13E-75; mr1342_2 (All); LR P-value: 8.64E-18; mr1629_2 (All); LMM P-value: 2.04E-11; LR P-value: 7.24E-109; mr1905_2 (All); LR P-value: 1.63E-08; mr1944_2 (All); LR P-value: 9.49E-42 |
LOC_Os02g46460.1 Alt: G| missense_variant MODERATE(snpEff)
LOC_Os02g46460.2 Alt: G| missense_variant MODERATE(snpEff) LOC_Os02g46460.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2) LOC_Os02g46460.2 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2) The average chromatin accessibility score: 98.429; most accessible tissue: Minghui63 panicle, score: 99.573 |
| vg0228313524 (J) | chr02 | 28313524 | C | T | 99.80% | 0.00% | C -> T | NA |
LOC_Os02g46460.1 Alt: T| missense_variant MODERATE(snpEff)
LOC_Os02g46460.2 Alt: T| missense_variant MODERATE(snpEff) The average chromatin accessibility score: 98.428; most accessible tissue: Minghui63 panicle, score: 99.568 |
| vg0228313932 (J) | chr02 | 28313932 | A | G | 99.90% | 0.00% | A -> G | NA |
LOC_Os02g46460.1 Alt: G| splice_region_variant&intron_variant LOW(snpEff)
LOC_Os02g46460.2 Alt: G| splice_region_variant&intron_variant LOW(snpEff) LOC_Os02g46473.1 Alt: G| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 95.071; most accessible tissue: Minghui63 panicle, score: 98.973 |
| vg0228314271 (J) | chr02 | 28314271 | G | T | 95.40% | 0.00% | G -> T | NA |
LOC_Os02g46460.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os02g46460.2 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 96.924; most accessible tissue: Zhenshan97 flower, score: 99.394 |
| vg0228314303 (J) | chr02 | 28314303 | C | A | 99.70% | 0.00% | C -> A | NA |
LOC_Os02g46460.1 Alt: A| missense_variant MODERATE(snpEff)
LOC_Os02g46460.2 Alt: A| missense_variant MODERATE(snpEff) LOC_Os02g46473.1 Alt: A| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 97.212; most accessible tissue: Zhenshan97 flower, score: 99.528 |
| vg0228314396 (J) | chr02 | 28314396 | G | A | 96.90% | 0.00% | G -> A | NA |
LOC_Os02g46460.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os02g46460.2 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 97.125; most accessible tissue: Minghui63 panicle, score: 99.726 |
| vg0228314556 (J) | chr02 | 28314556 | A | ACGCGCA ACGCGAC CGCGATG TGCCTTG GGCCGAT | 96.20% | 0.00% | A -> ACGCGCAACG CGACCGCGAT GTGCCTTGGG CCGAT | NA |
LOC_Os02g46473.1 Alt: ACGCGCAACGCGACCGCGATGTGCCTTGGGCCGAT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.1 Alt: ACGCGCAACGCGACCGCGATGTGCCTTGGGCCGAT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: ACGCGCAACGCGACCGCGATGTGCCTTGGGCCGAT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 98.254; most accessible tissue: Minghui63 panicle, score: 99.866 |
| vg0228314900 (J) | chr02 | 28314900 | GGCGC | G | 99.30% | 0.00% | GGCGC -> G | NA |
LOC_Os02g46473.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)
LOC_Os02g46460.1 Alt: G| intron_variant MODIFIER(snpEff) LOC_Os02g46460.2 Alt: G| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 91.915; most accessible tissue: Minghui63 panicle, score: 99.063 |
| vg0228314918 (J) | chr02 | 28314918 | C | A | 59.30% | 0.23% | A -> C |
mr1125 (All); LR P-value: 3.59E-48;
mr1151 (All); LR P-value: 1.28E-09; mr1246 (All); LR P-value: 2.03E-62; mr1249 (All); LR P-value: 1.47E-07; mr1379 (All); LR P-value: 4.96E-10; mr1558 (All); LR P-value: 1.29E-48; mr1559 (All); LR P-value: 1.92E-07; mr1721 (All); LR P-value: 1.07E-41; mr1883 (All); LR P-value: 1.76E-11; mr1943 (All); LR P-value: 1.86E-21; mr1039_2 (All); LR P-value: 4.38E-28; mr1125_2 (All); LR P-value: 7.25E-64; mr1133_2 (All); LR P-value: 2.02E-14; mr1151_2 (All); LR P-value: 1.34E-12; mr1509_2 (All); LR P-value: 2.13E-43; mr1558_2 (All); LR P-value: 1.66E-58; mr1580_2 (All); LR P-value: 2.68E-30; mr1721_2 (All); LR P-value: 5.97E-48; mr1825_2 (All); LR P-value: 3.43E-29; mr1922_2 (All); LR P-value: 9.41E-21 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os02g46473.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 92.015; most accessible tissue: Minghui63 panicle, score: 99.075 |
| vg0228314925 (J) | chr02 | 28314925 | A | C | 59.10% | 0.23% | C -> A |
mr1125 (All); LR P-value: 3.86E-49;
mr1151 (All); LR P-value: 1.62E-09; mr1246 (All); LR P-value: 8.17E-64; mr1379 (All); LR P-value: 1.04E-09; mr1509 (All); LR P-value: 5.33E-41; mr1558 (All); LR P-value: 3.81E-49; mr1721 (All); LR P-value: 2.09E-40; mr1943 (All); LR P-value: 1.13E-21; mr1125_2 (All); LR P-value: 2.04E-65; mr1151_2 (All); LR P-value: 1.94E-12; mr1509_2 (All); LR P-value: 9.92E-45; mr1558_2 (All); LR P-value: 3.51E-59; mr1580_2 (All); LR P-value: 1.02E-29; mr1922_2 (All); LR P-value: 3.11E-20 |
LOC_Os02g46473.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 92.528; most accessible tissue: Minghui63 panicle, score: 98.994 |
| vg0228315212 (J) | chr02 | 28315212 | G | C | 95.00% | 0.00% | G -> C |
mr1016 (Jap_All); LR P-value: 2.15E-09;
mr1018 (Jap_All); LR P-value: 5.34E-10; mr1019 (Jap_All); LR P-value: 1.76E-08; mr1055 (Jap_All); LR P-value: 2.77E-11; mr1132 (Jap_All); LR P-value: 2.15E-10; mr1236 (Jap_All); LR P-value: 8.49E-07; mr1248 (Jap_All); LR P-value: 9.60E-09; mr1518 (Jap_All); LR P-value: 3.48E-06; mr1676 (Jap_All); LR P-value: 7.50E-07; mr1780 (Jap_All); LR P-value: 4.08E-06; mr1951 (Jap_All); LR P-value: 9.51E-07; mr1019_2 (Jap_All); LR P-value: 3.30E-10; mr1022_2 (Jap_All); LR P-value: 4.65E-09; mr1055_2 (Jap_All); LR P-value: 5.71E-13; mr1132_2 (Jap_All); LR P-value: 3.31E-14; mr1390_2 (Jap_All); LR P-value: 4.39E-15; mr1490_2 (Jap_All); LR P-value: 2.80E-15; mr1676_2 (Jap_All); LR P-value: 1.14E-08 |
LOC_Os02g46473.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 89.839; most accessible tissue: Minghui63 flower, score: 98.069 |
| vg0228315411 (J) | chr02 | 28315411 | G | C | 59.30% | 0.21% | C -> G |
mr1125 (All); LR P-value: 3.59E-48;
mr1151 (All); LR P-value: 1.28E-09; mr1246 (All); LR P-value: 2.03E-62; mr1249 (All); LR P-value: 1.47E-07; mr1379 (All); LR P-value: 4.96E-10; mr1558 (All); LR P-value: 1.29E-48; mr1559 (All); LR P-value: 1.92E-07; mr1721 (All); LR P-value: 1.07E-41; mr1883 (All); LR P-value: 1.76E-11; mr1943 (All); LR P-value: 1.86E-21; mr1039_2 (All); LR P-value: 4.38E-28; mr1125_2 (All); LR P-value: 7.25E-64; mr1133_2 (All); LR P-value: 2.02E-14; mr1151_2 (All); LR P-value: 1.34E-12; mr1509_2 (All); LR P-value: 2.13E-43; mr1558_2 (All); LR P-value: 1.66E-58; mr1580_2 (All); LR P-value: 2.68E-30; mr1721_2 (All); LR P-value: 5.97E-48; mr1825_2 (All); LR P-value: 3.43E-29; mr1922_2 (All); LR P-value: 9.41E-21 |
LOC_Os02g46473.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 86.458; most accessible tissue: Minghui63 flower, score: 98.228 |
| vg0228315417 (J) | chr02 | 28315417 | C | T | 59.30% | 0.21% | T -> C |
mr1125 (All); LR P-value: 3.59E-48;
mr1151 (All); LR P-value: 1.28E-09; mr1246 (All); LR P-value: 2.03E-62; mr1249 (All); LR P-value: 1.47E-07; mr1379 (All); LR P-value: 4.96E-10; mr1558 (All); LR P-value: 1.29E-48; mr1559 (All); LR P-value: 1.92E-07; mr1721 (All); LR P-value: 1.07E-41; mr1883 (All); LR P-value: 1.76E-11; mr1943 (All); LR P-value: 1.86E-21; mr1039_2 (All); LR P-value: 4.38E-28; mr1125_2 (All); LR P-value: 7.25E-64; mr1133_2 (All); LR P-value: 2.02E-14; mr1151_2 (All); LR P-value: 1.34E-12; mr1509_2 (All); LR P-value: 2.13E-43; mr1558_2 (All); LR P-value: 1.66E-58; mr1580_2 (All); LR P-value: 2.68E-30; mr1721_2 (All); LR P-value: 5.97E-48; mr1825_2 (All); LR P-value: 3.43E-29; mr1922_2 (All); LR P-value: 9.41E-21 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os02g46473.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.2 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 86.772; most accessible tissue: Minghui63 flower, score: 98.281 |
| vg0228315839 (J) | chr02 | 28315839 | C | G | 92.70% | 0.00% | C -> G | NA |
LOC_Os02g46460.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os02g46460.2 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 78.561; most accessible tissue: Minghui63 flower, score: 96.440 |
| vg0228315902 (J) | chr02 | 28315902 | C | T | 99.90% | 0.00% | C -> T | NA |
LOC_Os02g46460.2 Alt: T| 5_prime_UTR_variant MODIFIER(snpEff)
LOC_Os02g46473.1 Alt: T| downstream_gene_variant MODIFIER(snpEff) LOC_Os02g46460.1 Alt: T| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 75.965; most accessible tissue: Minghui63 flower, score: 95.829 |
| vg0228315906 (J) | chr02 | 28315906 | T | C | 51.40% | 0.23% | C -> T |
mr1063 (All); LR P-value: 1.80E-49;
mr1164 (All); LR P-value: 4.37E-15; mr1208 (All); LR P-value: 8.59E-31; mr1221 (All); LR P-value: 3.58E-28; mr1426 (All); LR P-value: 4.24E-27; mr1524 (All); LR P-value: 9.66E-10; mr1946 (All); LR P-value: 1.24E-07; mr1063_2 (All); LR P-value: 1.40E-49; mr1164_2 (All); LR P-value: 2.20E-21; mr1189_2 (All); LR P-value: 4.88E-12; mr1244_2 (All); LR P-value: 4.02E-24; mr1260_2 (All); LR P-value: 6.58E-17; mr1514_2 (All); LR P-value: 8.37E-13; mr1580_2 (All); LR P-value: 2.54E-29; mr1734_2 (All); LR P-value: 5.28E-11; mr1782_2 (All); LR P-value: 4.82E-10 |
LOC_Os02g46460.2 Alt: T| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46473.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46460.1 Alt: T| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 76.918; most accessible tissue: Minghui63 flower, score: 96.133 |
| vg0228316176 (J) | chr02 | 28316176 | G | A | 95.20% | 0.00% | G -> A | NA |
LOC_Os02g46460.1 Alt: A| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g46460.2 Alt: A| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os02g46473.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 89.238; most accessible tissue: Minghui63 flower, score: 97.920 |
| STR0228316176 (J) | chr02 | 28316176 | G | A | 95.60% | 0.00% | G -> A | NA |
|