| Variant ID: vg0221167854 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 21167854 |
| Reference Allele: AT | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: AT |
Inferred Ancestral Allele: Not determined.
TTGGATTGAATAAAATTTAGTGTGATCTTTCAACTAGTTTGGATGTGATGTTCTTGGTTGTTACTGTCTAACACCCTTATTGGTTATGTGCCACTTCAAT[AT/A]
TTTTTTTTTAATCTTTGTTACTCTGTTACCAATTATTTCACCCTTGACAATGTTTTGCTTGGCAGGTATTGTGTTGTTCTTGATGATATATGGAGTATTT
AAATACTCCATATATCATCAAGAACAACACAATACCTGCCAAGCAAAACATTGTCAAGGGTGAAATAATTGGTAACAGAGTAACAAAGATTAAAAAAAAA[AT/T]
ATTGAAGTGGCACATAACCAATAAGGGTGTTAGACAGTAACAACCAAGAACATCACATCCAAACTAGTTGAAAGATCACACTAAATTTTATTCAATCCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 31.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0221167854 | AT -> A | LOC_Os02g35200.1 | downstream_gene_variant ; 2169.0bp to feature; MODIFIER | silent_mutation | Average:52.822; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0221167854 | AT -> A | LOC_Os02g35220.1 | downstream_gene_variant ; 2674.0bp to feature; MODIFIER | silent_mutation | Average:52.822; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |
| vg0221167854 | AT -> A | LOC_Os02g35210.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.822; most accessible tissue: Minghui63 flag leaf, score: 73.334 | N | N | N | N |