| Variant ID: vg1217809715 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 17809715 |
| Reference Allele: GAACCAAGGGGTTTA | Alternative Allele: AAACCAAGGGGTTTA,G |
| Primary Allele: GAACCAAGGGGTTTA | Secondary Allele: AAACCAAGGGGTTTA |
Inferred Ancestral Allele: Not determined.
GCATGGGAATTATCGGAAATGCCCCGAATCCGCCGTCAGGAGTTCATCCGGAGCGTCCACGCCAAACCCCAGCCTGAACGGCTGTGATGGGGGTTTGGCC[GAACCAAGGGGTTTA/AAACCAAGGGGTTTA,G]
GCCGAACCATGATCTGGCCCAAACGGCCCAATTTTTGGCAGGCCGACTCCTTATTTGCTTCTTAATCCAAAACATGGAATTTTGGGCTTAATTGATCGTG
CACGATCAATTAAGCCCAAAATTCCATGTTTTGGATTAAGAAGCAAATAAGGAGTCGGCCTGCCAAAAATTGGGCCGTTTGGGCCAGATCATGGTTCGGC[TAAACCCCTTGGTTC/TAAACCCCTTGGTTT,C]
GGCCAAACCCCCATCACAGCCGTTCAGGCTGGGGTTTGGCGTGGACGCTCCGGATGAACTCCTGACGGCGGATTCGGGGCATTTCCGATAATTCCCATGC
| Populations | Population Size | Frequency of GAACCAAGGGGTTTA(primary allele) | Frequency of AAACCAAGGGGTTTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.80% | 10.20% | 2.90% | 32.90% | G: 1.18% |
| All Indica | 2759 | 45.30% | 17.10% | 3.84% | 32.73% | G: 0.98% |
| All Japonica | 1512 | 69.40% | 0.40% | 0.93% | 29.23% | G: 0.07% |
| Aus | 269 | 36.10% | 0.70% | 2.97% | 51.30% | G: 8.92% |
| Indica I | 595 | 49.10% | 41.20% | 1.01% | 8.74% | NA |
| Indica II | 465 | 34.20% | 6.50% | 2.37% | 56.56% | G: 0.43% |
| Indica III | 913 | 45.80% | 9.00% | 5.04% | 37.90% | G: 2.30% |
| Indica Intermediate | 786 | 48.50% | 14.80% | 5.47% | 30.79% | G: 0.51% |
| Temperate Japonica | 767 | 95.80% | 0.30% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 39.10% | 0.60% | 1.19% | 58.93% | G: 0.20% |
| Japonica Intermediate | 241 | 48.50% | 0.40% | 3.32% | 47.72% | NA |
| VI/Aromatic | 96 | 39.60% | 0.00% | 6.25% | 50.00% | G: 4.17% |
| Intermediate | 90 | 66.70% | 3.30% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1217809715 | GAACCAAGGGGTTTA -> AAACCAAGGGGTTTA | LOC_Os12g29790.1 | upstream_gene_variant ; 3898.0bp to feature; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> AAACCAAGGGGTTTA | LOC_Os12g29800.1 | downstream_gene_variant ; 827.0bp to feature; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> AAACCAAGGGGTTTA | LOC_Os12g29790-LOC_Os12g29800 | intergenic_region ; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> DEL | N | N | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> G | LOC_Os12g29790.1 | upstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> G | LOC_Os12g29800.1 | downstream_gene_variant ; 826.0bp to feature; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| vg1217809715 | GAACCAAGGGGTTTA -> G | LOC_Os12g29790-LOC_Os12g29800 | intergenic_region ; MODIFIER | silent_mutation | Average:27.266; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1217809715 | NA | 5.35E-06 | mr1081 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 4.43E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | 7.99E-06 | 2.94E-07 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 7.00E-06 | mr1461 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | 3.73E-07 | 3.73E-07 | mr1849 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 3.30E-08 | mr1864 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | 4.62E-06 | 1.63E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 1.62E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 3.61E-07 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1217809715 | NA | 1.12E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |